Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Nostoc punctiforme
Genetic Insert: NpuDnaE intein, inactive
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23974115
Proper citation: RRID:Addgene_46376 Copy
Species: Nostoc punctiforme
Genetic Insert: NpuDnaE intein delta variant, inactive
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23974115
Proper citation: RRID:Addgene_46377 Copy
Species: Nostoc punctiforme
Genetic Insert: NpuDnaB intein
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3564; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23974115
Proper citation: RRID:Addgene_46373 Copy
Species: Homo sapiens
Genetic Insert: 4.1G C-terminal domain
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23870127
Comments: Neuromodulin N-terminal sequence is MLCCMRRTKQVEKNDDDQKI
Proper citation: RRID:Addgene_46362 Copy
Species: Nostoc punctiforme
Genetic Insert: GFPN-NpuDnaE_intein-GFP_C
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pRSF-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23974115
Proper citation: RRID:Addgene_46832 Copy
Species: Synthetic
Genetic Insert: AtU6p::sgRNA_PDS
Vector Backbone Description: Backbone Size:6340; Vector Backbone:pICH86966; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23929340
Comments: gRNA target sequence GCCGTTAATTTGAGAGTCCA
Proper citation: RRID:Addgene_46966 Copy
Species: Synthetic
Genetic Insert: FLAG tag
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23897892
Proper citation: RRID:Addgene_46956 Copy
Species: Homo sapiens
Genetic Insert: Ku70
Vector Backbone Description: Backbone Size:4766; Vector Backbone:pEGFP-C1-FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23897892
Proper citation: RRID:Addgene_46957 Copy
Species: Homo sapiens
Genetic Insert: Mitotrap
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEYFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20159602
Proper citation: RRID:Addgene_46942 Copy
Species: Homo sapiens
Genetic Insert: FJX1
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag 4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_46931 Copy
Species: Homo sapiens
Genetic Insert: Park2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4698; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23319602
Proper citation: RRID:Addgene_46924 Copy
Vector Backbone Description: Backbone Size:8278; Vector Backbone:pMSP3535VA; Vector Types:Bacterial Expression, Nisin-inducible expression; Gram-positive Bacterial Shuttle Vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10964628
Comments: This plasmid utilizes the NIsin Controlled Expression (NICE) system. NICE® is a registered trademark of NIZO food research BV, P.O.Box 20, 6710 BA Ede, The Netherlands.
pMSP3535VA contains the Nisin-inducible PnisA promoter, and the pVA380-1 replicon for expression in gram-positive bacteria.
For protein expression in E. faecalis, induce with 10-25 ng/mL nisin (Sigma, N-5764). See associated article for instructions on how to make nisin solution.
Note: Nucleotide sequence encoding the signal sequence and one-third of the mature NisA (nisin) peptide remains associated with the PnisA promoter. The depositing laboratory recommends adding of a Stop codon to the 5' end of inserted sequences to avoid unintentional gene fusions.
Note: The theoretical full sequence uploaded here is NOT fully accurate - the NheI site at position 4414 has been lost, along with approximately 500bp of sequence in this region (compare the depositor's uploaded maps). The actual size of this plasmid is 8278 as listed here. The depositing lab has not resequenced the region in question, but the discrepancy does not affect plasmid function.
Note: This plasmid has been shown to accumulate deletions when replicated in E. coli (or gram-negative bacteria). Screening transformants by restriction digest is recommended.
Addgene's quality control sequencing finds discrepancies with the depositor's provided sequence, but they are not thought to affect plasmid function.
Proper citation: RRID:Addgene_46887 Copy
Species: Oryza sativa
Genetic Insert: mPing
Vector Backbone Description: Backbone Size:9900; Vector Backbone:pUQ218; Vector Types:plant expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21844309
Proper citation: RRID:Addgene_47101 Copy
Species: Mus musculus
Genetic Insert: BMAL
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22653727
Proper citation: RRID:Addgene_47371 Copy
Species: Mus musculus
Genetic Insert: BMAL
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22653727
Proper citation: RRID:Addgene_47372 Copy
Species: Mus musculus
Genetic Insert: BMAL
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22653727
Proper citation: RRID:Addgene_47366 Copy
Species: Mus musculus
Genetic Insert: BMAL
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22653727
Proper citation: RRID:Addgene_47365 Copy
Species: Mus musculus
Genetic Insert: Clock
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22653727
Proper citation: RRID:Addgene_47358 Copy
Species: Mus musculus
Genetic Insert: Clock
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22653727
Proper citation: RRID:Addgene_47355 Copy
Species: Mus musculus
Genetic Insert: Clock
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22653727
Proper citation: RRID:Addgene_47356 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
