Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Aequorea victoria
Genetic Insert: yEGFP
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34860007
Comments: Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). yEGFP gene from Kaishima, M. et al Sci Rep 2016.
Proper citation: RRID:Addgene_176181 Copy
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34860007
Comments: Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). 5' cloning site: BsmBI (destroyed during cloning), 3' cloning site: BsmBI (destroyed during cloning).
Proper citation: RRID:Addgene_176184 Copy
Vector Backbone Description: Vector Backbone:pMCL8; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:34860007
Proper citation: RRID:Addgene_176185 Copy
Species: Homo sapiens
Genetic Insert: EGFP-T2A-TFEB(human; delta30; amino acids 31-476)
Vector Backbone Description: Vector Backbone:pCamR; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29507340
Proper citation: RRID:Addgene_176500 Copy
Genetic Insert: puroR-T2A-TetOn3G
Vector Backbone Description: Vector Backbone:pCamR; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29507340
Comments: Addgene QC identified a P93S difference in the PuroR selectable marker that the depositing lab does not believe to affect function.
Proper citation: RRID:Addgene_176496 Copy
Species: Homo sapiens
Genetic Insert: EGFP-T2A-TFEB(human; full-length; S3E mutation)-
Vector Backbone Description: Vector Backbone:pCamR; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29507340
Proper citation: RRID:Addgene_176499 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Mitochondrial FAD-linked sulfhydryl oxidase
Vector Backbone Description: Backbone Size:5068; Vector Backbone:pACYC184-TU2A-RFP; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.08.31.458447v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_176405 Copy
Species: Other
Genetic Insert: FAD-linked sulfhydryl oxidase ERV2 from Fol
Vector Backbone Description: Backbone Size:5068; Vector Backbone:pACYC184-TU2A-RFP; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.08.31.458447v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_176404 Copy
Genetic Insert: pRARE2 plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.
Primers for recBCD deletion verification:
Foward - ttgatttactgcccgagagc
Reverse - gtcaaccgaatgcagacatc
Proper citation: RRID:Addgene_176583 Copy
Genetic Insert: pRARE2 plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.
Primers for recB deletion verification:
Foward - tattttccagtcgtgaaagc
Reverse - ttgctgatttcttccatcag
Proper citation: RRID:Addgene_176582 Copy
Species: Candida albicans
Genetic Insert: bar1Ca
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.
Proper citation: RRID:Addgene_176734 Copy
Species: Kazachstania naganishii
Genetic Insert: bar1Kn
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.
Proper citation: RRID:Addgene_176737 Copy
Species: Kluyveromyces lactis
Genetic Insert: bar1Kl
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.
Proper citation: RRID:Addgene_176736 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: ste2Sc
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.
Proper citation: RRID:Addgene_176731 Copy
Species: Lachancea thermotolerans
Genetic Insert: ste2Lt
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.
Proper citation: RRID:Addgene_176730 Copy
Species: Candida albicans
Genetic Insert: ste2Ca
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.
Proper citation: RRID:Addgene_176723 Copy
Species: Kluyveromyces lactis
Genetic Insert: ste2Kl
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.
Proper citation: RRID:Addgene_176726 Copy
Species: Lachancea fermentati
Genetic Insert: ste2Lf
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.
Proper citation: RRID:Addgene_176728 Copy
Species: Vanderwaltozyma polyspora
Genetic Insert: mfalpha1Vp
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.
Proper citation: RRID:Addgene_176722 Copy
Species: Eremothecium cymbalariae
Genetic Insert: mfalpha1Ec
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Comments: The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint.
Proper citation: RRID:Addgene_176713 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
