Plasmids   Select Another Resource Report Type

http://www.addgene.org/41065

Vector Backbone Description: Backbone Size:4146; Vector Backbone:pTKIP; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:20047970

Proper citation: RRID:Addgene_41065 Copy   

•   Source: Addgene

http://www.addgene.org/36436

Genetic Insert: Gateway Cassette
Vector Backbone Description: Vector Backbone:pMartini; Vector Types:Gateway Conversion Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22848718
Comments: This vector can be used for conversion of any cloning vector into a gateway destination vector and facilitate the generation of in-frame fusions with a gateway cassette. A,B or C are reading frames; R1-R2 or R2-R1 indicate the gateway cassette orientation. Please see the associated publication for more information: Wang J-W, Beck ES, McCabe BD (2012) A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila. PLoS ONE 7(7): e42102 http://www.plosone.org/article/info:doi%2F10.1371%2Fjournal.pone.0042102

Proper citation: RRID:Addgene_36436 Copy   

•   Source: Addgene

http://www.addgene.org/36425

Genetic Insert: Gateway Cassette
Vector Backbone Description: Vector Backbone:pMartini; Vector Types:Gateway Conversion Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22848718
Comments: This vector can be used for conversion of any cloning vector into a gateway destination vector and facilitate the generation of in-frame fusions with a gateway cassette. A,B or C are reading frames; R1-R2 or R2-R1 indicate the gateway cassette orientation. Please see the associated publication for more information: Wang J-W, Beck ES, McCabe BD (2012) A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila. PLoS ONE 7(7): e42102 http://www.plosone.org/article/info:doi%2F10.1371%2Fjournal.pone.0042102

Proper citation: RRID:Addgene_36425 Copy   

•   Source: Addgene

http://www.addgene.org/164520

Vector Backbone Description: Vector Backbone:PB-TAG-ERN; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:33080218

Proper citation: RRID:Addgene_164520 Copy   

•   Source: Addgene

http://www.addgene.org/16667

Genetic Insert: mTn7::Gateway cassette
Vector Backbone Description: Backbone Size:14263; Vector Backbone:pGRG37; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:16646962
Comments: Grow at 32'C. Contains Gateway cassette with ccdB gene. See author's protocol for more information. This plasmid is designed to insert DNA into the chromosome of Enterobacteria in a manner that doesn't require a drug resistance marker. This plasmid uses the site-specific recombination machinery of the bacterial transposon Tn7. The backbone of the plasmid is the easily curable temperature sensitive mutant of pSC101.

Proper citation: RRID:Addgene_16667 Copy   

•   Source: Addgene

http://www.addgene.org/177795

Vector Backbone Description: Backbone Size:10394; Vector Backbone:pDEST-AD-CYH2; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35137167
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.27.453987v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_177795 Copy   

•   Source: Addgene

http://www.addgene.org/177798

Vector Backbone Description: Backbone Size:10164; Vector Backbone:pDEST-DB; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35137167
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.27.453987v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_177798 Copy   

•   Source: Addgene

http://www.addgene.org/177797

Vector Backbone Description: Backbone Size:10388; Vector Backbone:pDEST-AD-CYH2; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35137167
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.27.453987v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_177797 Copy   

•   Source: Addgene

http://www.addgene.org/177809

Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35087108
Comments: This plasmid was designed to tag transcripts of insert at the 3' with an 12X MS2 stem loop tag. Insertion of the transcript of interst is performed by BsaI cloning. 5' BsaI generates ACAG overhang (BsaI recognition site 2659-2664) 3' BsaI generates CCCG overhang (BsaI recognition site 4086-4091) These BsaI sites are lost upon insertion of the transcript of interest.

Proper citation: RRID:Addgene_177809 Copy   

•   Source: Addgene

http://www.addgene.org/178083

Vector Backbone Description: Backbone Marker:NA, NA, Invitrogen; Vector Backbone:pGP704, pBAD33, pDONR201; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:34801582
Comments: The plasmids from this article are also used with plasmid pXint129 (www.addgene.org/178208).

Proper citation: RRID:Addgene_178083 Copy   

•   Source: Addgene

http://www.addgene.org/17555

Species: Mus musculus
Genetic Insert: Foxo1-WT-DBD
Vector Backbone Description: Backbone Size:5600; Vector Backbone:pDNR-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:17717603
Comments: This plasmid also contains a E226G mutation--the author has determined that this mutation does not affect the plasmid detrimentally. It also has K219R and L619P polymorphisms.

Proper citation: RRID:Addgene_17555 Copy   

•   Source: Addgene

http://www.addgene.org/176584

Genetic Insert: pRARE2 + pBADmod1-linker2-gamS plasmid
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for genomic verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca

Proper citation: RRID:Addgene_176584 Copy   

•   Source: Addgene

http://www.addgene.org/176586

Genetic Insert: pRARE2 + pBADmod1-linker2-gamS plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca

Proper citation: RRID:Addgene_176586 Copy   

•   Source: Addgene

http://www.addgene.org/168207

Vector Backbone Description: Backbone Size:7721; Vector Backbone:pFRT; Vector Types:Mammalian Expression, Unspecified, pDEST GATEWAY; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:30478324

Proper citation: RRID:Addgene_168207 Copy   

•   Source: Addgene

http://www.addgene.org/102563

Vector Backbone Description: Backbone Size:16156; Vector Backbone:PB-SAM; Vector Types:Mammalian Expression, CRISPR, piggybac transposon; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:28918057

Proper citation: RRID:Addgene_102563 Copy   

•   Source: Addgene

http://www.addgene.org/160092

Vector Backbone Description: Backbone Size:9363; Vector Backbone:pLX304 backbone; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:32371478

Proper citation: RRID:Addgene_160092 Copy   

•   Source: Addgene

http://www.addgene.org/17392

Vector Backbone Description: Backbone Size:9796; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19657394
Comments: Please note that Addgene's quality control sequence shows several gaps with depositor's reference sequence. These gaps are in vector region only and should not affect function.

Proper citation: RRID:Addgene_17392 Copy   

•   Source: Addgene

http://www.addgene.org/17386

Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:8832; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19657394

Proper citation: RRID:Addgene_17386 Copy   

•   Source: Addgene

http://www.addgene.org/17399

Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:9150; Vector Backbone:pQCXIN; Vector Types:Retroviral, RNAi, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19657394

Proper citation: RRID:Addgene_17399 Copy   

•   Source: Addgene

http://www.addgene.org/17431

Vector Backbone Description: Backbone Size:10140; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19657394
Comments: Please note that there are several sequence discrepancies between Addgene's sequence and depositor's sequence. These mismatches are in backbone regions and should not affect function.

Proper citation: RRID:Addgene_17431 Copy   

•   Source: Addgene