Plasmids   Select Another Resource Report Type

http://www.addgene.org/188479

Genetic Insert: P-R-lox-TT-lox-cat
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188479 Copy   

•   Source: Addgene

http://www.addgene.org/197655

Species: n/a
Genetic Insert: This strain is a derivative of BL21(DE3) with no specific assignment of the UAG codo
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:31243963
Comments: Derivative of BL21(DE3) with no specific assignment of the UAG codon - 95 endogenous TAG codons mutated to TAA - RF1 (prfA) deleted and fabR spontaneously mutated - serB deleted for phosphoserine genetic code expansion expression applications Primers for verification: - for RF1 (prfA) deletion: AAGCCTTCTATCGTTGCCAAAC, TTATTCCTGCTCGGACAACG - for serB deletion: AGTTTTGTGCGAGCCATCTTCCACC, GTGATGGTGTTCCAGGCATGACAGG This strain is used for expressing phosphoserine-containig proteins using genetic code expansion without buildup of prematurely truncated protein - Recommended plasmids for expressing phosphorylated proteins in this strain are Addgene #173897 (pSer GCE machinery vector) and #174075/174076 (compatible p15a origin of replication plasmids expressing sfGFP proteins from a T7 promoter; sfGFP genes can be removed by restriction digest and replaced with protein-of-interest). Original B95 strain: Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672

Proper citation: RRID:Addgene_197655 Copy   

•   Source: Addgene

http://www.addgene.org/197656

Species: n/a
Genetic Insert: This strain is a derivative of BL21(DE3) with the serC gene knocked out
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:37122473
Comments: Strain is resistant to chloramphenicol. Derivative of BL21(DE3) with the serC gene knocked out. This strain is used for expressing proteins containing site-specific non-hydrolyzable phosphoserine. Primers for verification: - for serC deletion: CCTCAACGGTTTTACTCATTGCGATG, CGGGCAGATTAATAGTGCCATCGAC Additional reference: Rogerson et al. Efficient genetic encoding of phosphoserine and its nonhydrolyzable analog. Nat Chem Biol. 2015 Jul;11(7):496-503 Please visit https://www.biorxiv.org/content/10.1101/2021.10.22.465468v2 for bioRxiv preprint.

Proper citation: RRID:Addgene_197656 Copy   

•   Source: Addgene

http://www.addgene.org/186997

Species: E. coli
Genetic Insert: bglR, thi-1, rel-1 HfrPO1, ∆nuoA-N
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:16979134
Comments: Parent strain is 1100, from Humbert et al. 1983 J Bacteriol. doi.org/10.1128/jb.153.1.416-422.1983

Proper citation: RRID:Addgene_186997 Copy   

•   Source: Addgene

http://www.addgene.org/180310

Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:35077145
Comments: Genotype: E. coli MG1655ΔCRISPR-Cas Method: Knockout using pKD46/pKD4 Created by: Baiyang Liu Knockout region from MG1655 genome: 995605 to 1006007 Primer Fw: GATTATCGACTGGGATAACC Primer Rv: CAGAAATATTCGACAAAGCG Expected PCR size for JEC027: 1kb Expected PCR size for MG1655: 10.4kb

Proper citation: RRID:Addgene_180310 Copy   

•   Source: Addgene

http://www.addgene.org/138651

Species: E. coli
Genetic Insert: None
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:31772280
Comments: Genotype: λDE3 Δtig100 Δ(araD–araB)567 ΔlacZ4787(::rrnB-3) lacIP-4000(lacIQ) rph-1 Δ(rhaD–rhaB)568 hsdR514 KTD101(DE3) is a λDE3 derivative of the trigger factor deficient (Δtig) strain KTD101 from Puertas et al 2010 Protein Expression and Purification 74: 122–128, PMID 20600941. Puertas et al 2010 showed that deletion of trigger factor in the parent strain KTD101 increased the level of secreted recombinantly expressed protein. This strain may also improve the level of protein expression in the periplasm and in the outer membrane. This derivative strain KTD101(DE3) now allows expression that is based on the widely-used T7 promoter. The parent strain KTD101 was provided by François Baneyx at the University of Washington. DE3 lysogenization is apparent from positive expression that was obtained for the BBA57 protein upon expression from the T7 promoter plasmid pBBA57-TEV-His12, as was shown in Figure S5C, lane 7, of Robertson et al, Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x.

Proper citation: RRID:Addgene_138651 Copy   

•   Source: Addgene

http://www.addgene.org/83308

Species: Mus musculus
Genetic Insert: FoxO1
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:3390; Vector Backbone:pSELECT-puro; Vector Types:Mammalian Expression; Bacterial Resistance:None
Defining Citation: PMID:27511131
Comments: To construct pSELECT-HA-mFOXO1 the coding sequence of HA tag and FOXO1 were amplified from pCMV-HA-FOXO1 by PCR. The PCR product was digested with NheI and SalI restriction enzymes and inserted into the NheI and SalI sites of pSELECT-puro. The insert was sequenced and compared to mouse FOXO1 (NM_019739.3). Sequence identity was confirmed except for a conservative A->G mutation at base 474, a non-conservative A->G mutation at base 1121 and a non-conservative mutation T->C mutation at base 2321 of NM_019739.3. These mutations were confirmed to exist in the original pCMV-HA-FOXO1 plasmid. The non-conservative mutations result in a K->R substitution at amino acid 219 and a L->P substitution at amino acid 619 of mFOXO1 (NP_062713.2). Mutations at bases 1121 and 2321 were reversed to wild type by site-directed mutagenesis and the corrections were confirmed by sequencing

Proper citation: RRID:Addgene_83308 Copy   

•   Source: Addgene

http://www.addgene.org/78551

Genetic Insert: pTet--dCas9 cassette integrated at 186 primary attB site.
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:27060147

Proper citation: RRID:Addgene_78551 Copy   

•   Source: Addgene

http://www.addgene.org/215355

Genetic Insert: na
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:38352175
Comments: Genotype: ATCC14048 + ∆dns + camR + tfoX + lacI (nonfunctional). Supporting References: Chromosome 1 sequence: https://benchling.com/s/seq-9rfOeT70F35Li9CNjCnA?m=slm-n4lGsmu5T0KaunpiH620. Culture in LBv2 or LBv3 broth with 2ug/mL chloramphenicol. Recipe for LBv2: https://www.protocols.io/view/growth-media-for-v-natriegens-kqdg349j7l25/v1. Please visit https://www.biorxiv.org/content/10.1101/2023.08.11.553013v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_215355 Copy   

•   Source: Addgene

http://www.addgene.org/215356

Genetic Insert: na
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:38352175
Comments: This is the NC1 strain (Addgene #215355) with a deletion of the camR gene. Genotype: ATCC14048 + ∆dns + tfoX + lacI (nonfunctional). Supporting References: Chromosome 1 sequence: https://benchling.com/s/seq-HxxOFAiNbpHxSWT82Qju?m=slm-bQ5JkVI3VTiy0fDMPYr8. Recipe for LBv2: https://www.protocols.io/view/growth-media-for-v-natriegens-kqdg349j7l25/v1. Please visit https://www.biorxiv.org/content/10.1101/2023.08.11.553013v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_215356 Copy   

•   Source: Addgene

http://www.addgene.org/197113

Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
Comments: E. coli MEV15 is engineered to host diterpenoid biosynthetic pathways. Diterpenoid production is achieved by supplying the strain with plasmids encoding terpene cyclase(s) and cytochrome P450s under the control of Marionette promoters (See https://www.addgene.org/kits/marionette-sensor-collection/ and 10.1038/s41589-018-0168-3). Diterpenoid production can be induced by IPTG, vanillic acid, and other inducers controlling cytorhcome P450s. The strain has the upper MEV pathway from pMevT (addgene #17815) inserted into 4418413/4418414, the lower MEV pathway from pMBIS (addgene #17817) and Streptomyces avermitilis ggps inserted into 4105665/4105664, the designed redox enzyme array inserteed into 3801913/3801912, and the Marionette cluster from sAJM.1506 (addgene #108254) inserted into 3753777/3752159 of E. coli BL21(DE3)'s genome. The nucleotide numbers are based on NCBI accession # NZ_CP053602. The redox enzyme array consists of fprD/fdxD from Streptomyces avermitilis, fpr/fldA from E. coli, fenr/fer1 from spinach chloroplasts, abd pdr/pdx (camA/camB) from Pseudomonas putida. The Marionette cluster was transferred using phage transduction, resulting in the replacement of nucleotides between 3745758/3839292 by those in the corresponding regions from sAJM.1506 (parent strain: E. coli MG1655), as evident by whole-genome sequencing.

Proper citation: RRID:Addgene_197113 Copy   

•   Source: Addgene

http://www.addgene.org/200838

Species: Escherichia coli str. K-12 substr. MG1655
Genetic Insert: Genotype: MG1655 rph+, ilvG+, ΔlacZ, ΔrapZ, ΔglmZ, ΔglmY
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:36987877
Comments: Primer to check deletions: ΔrapZ (5' check primer: GGATACCGAAGGTACTCCGG; 3' check primer: CGTAAGAGCACTTCAGCGTC); ΔglmZ (5' check primer: GTGTAGGATCAAGCTCAGG; 3' check primer: CGGACGCCTACGATTACGC); ΔglmY (5' check primer: GTCTCTTTTTAGCGACACAGTGGC; 3' check primer: GGTGTTACTCTCGTCAGACGCG)

Proper citation: RRID:Addgene_200838 Copy   

•   Source: Addgene

http://www.addgene.org/205015

Species: E. coli
Genetic Insert: ΔtnaA ΔtrpR
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:35594503
Comments: Primers for PCR verification: veri-trpR-F: AGCAGCTTATAACGCCGGACCAGGG veri-trpR-R: TGGTCCCGTGATGTCGCGTTATAC veri-tnaA-F: CTTGTTTTAGTAAATGATGGTGCTTG veri-tnaA-R: GATCAGTCATGATGCCACCTTTAGAG

Proper citation: RRID:Addgene_205015 Copy   

•   Source: Addgene

http://www.addgene.org/102264

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔlamB ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102264 Copy   

•   Source: Addgene

http://www.addgene.org/102260

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔompA ΔlamB Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102260 Copy   

•   Source: Addgene

http://www.addgene.org/102261

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔompA ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102261 Copy   

•   Source: Addgene

http://www.addgene.org/102258

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102258 Copy   

•   Source: Addgene

http://www.addgene.org/102259

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102259 Copy   

•   Source: Addgene

http://www.addgene.org/102268

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔompA ΔompC ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102268 Copy   

•   Source: Addgene

http://www.addgene.org/102269

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔlamB ΔompC ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102269 Copy   

•   Source: Addgene