Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pMC3-yeGFP Resource Report Resource Website |
RRID:Addgene_176181 | yEGFP | Aequorea victoria | Chloramphenicol | PMID:34860007 | Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). yEGFP gene from Kaishima, M. et al Sci Rep 2016. | Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:10:56 | 0 | |
|
pMCL8 Resource Report Resource Website |
RRID:Addgene_176184 | Chloramphenicol | PMID:34860007 | Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). 5' cloning site: BsmBI (destroyed during cloning), 3' cloning site: BsmBI (destroyed during cloning). | Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:10:56 | 0 | |||
|
pMCL8_28bp Resource Report Resource Website |
RRID:Addgene_176185 | Chloramphenicol | PMID:34860007 | Vector Backbone:pMCL8; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:10:56 | 0 | ||||
|
3927-64 Resource Report Resource Website |
RRID:Addgene_176500 | EGFP-T2A-TFEB(human; delta30; amino acids 31-476) | Homo sapiens | Chloramphenicol | PMID:29507340 | Vector Backbone:pCamR; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:10:59 | 0 | ||
|
3919-32 Resource Report Resource Website |
RRID:Addgene_176496 | puroR-T2A-TetOn3G | Chloramphenicol | PMID:29507340 | Addgene QC identified a P93S difference in the PuroR selectable marker that the depositing lab does not believe to affect function. | Vector Backbone:pCamR; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:10:59 | 0 | ||
|
3924-55 Resource Report Resource Website |
RRID:Addgene_176499 | EGFP-T2A-TFEB(human; full-length; S3E mutation)- | Homo sapiens | Chloramphenicol | PMID:29507340 | Vector Backbone:pCamR; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:10:59 | 0 | ||
|
pACYC-T7CyDisCo Resource Report Resource Website |
RRID:Addgene_176405 | Mitochondrial FAD-linked sulfhydryl oxidase | Saccharomyces cerevisiae | Chloramphenicol | Please visit https://www.biorxiv.org/content/10.1101/2021.08.31.458447v1 for bioRxiv preprint. | Backbone Size:5068; Vector Backbone:pACYC184-TU2A-RFP; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | Codon optimised for expression in E. coli | 2026-08-15 01:10:58 | 0 | |
|
pACYC-T7FunCyDisCo Resource Report Resource Website |
RRID:Addgene_176404 | FAD-linked sulfhydryl oxidase ERV2 from Fol | Other | Chloramphenicol | Please visit https://www.biorxiv.org/content/10.1101/2021.08.31.458447v1 for bioRxiv preprint. | Backbone Size:5068; Vector Backbone:pACYC184-TU2A-RFP; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | deleted amino acids 2-25, codon optimised for E. coli expression | 2026-08-15 01:10:58 | 0 | |
|
BL21 Rosetta2 ΔrecBCD Resource Report Resource Website 1+ mentions |
RRID:Addgene_176583 | pRARE2 plasmid | Chloramphenicol | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol | recBCD genomic deletion | 2026-08-15 01:11:00 | 1 | |
|
BL21 Rosetta2 ΔrecB Resource Report Resource Website |
RRID:Addgene_176582 | pRARE2 plasmid | Chloramphenicol | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recB deletion verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol | recB genomic deletion | 2026-08-15 01:11:00 | 0 | |
|
pYCTK030 Resource Report Resource Website |
RRID:Addgene_176734 | bar1Ca | Candida albicans | Chloramphenicol | The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint. | Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | Codon-optimized for expression in S. cerevisiae | 2026-08-15 01:11:01 | 0 | |
|
pYCTK033 Resource Report Resource Website |
RRID:Addgene_176737 | bar1Kn | Kazachstania naganishii | Chloramphenicol | The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint. | Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | Codon-optimized for expression in S. cerevisiae | 2026-08-15 01:11:01 | 0 | |
|
pYCTK032 Resource Report Resource Website |
RRID:Addgene_176736 | bar1Kl | Kluyveromyces lactis | Chloramphenicol | The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint. | Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | Codon-optimized for expression in S. cerevisiae | 2026-08-15 01:11:01 | 0 | |
|
pYCTK027 Resource Report Resource Website |
RRID:Addgene_176731 | ste2Sc | Saccharomyces cerevisiae | Chloramphenicol | The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint. | Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:11:01 | 0 | ||
|
pYCTK026 Resource Report Resource Website |
RRID:Addgene_176730 | ste2Lt | Lachancea thermotolerans | Chloramphenicol | The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint. | Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | Codon-optimized for expression in S. cerevisiae | 2026-08-15 01:11:01 | 0 | |
|
pYCTK019 Resource Report Resource Website |
RRID:Addgene_176723 | ste2Ca | Candida albicans | Chloramphenicol | The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint. | Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | Codon-optimized for expression in S. cerevisiae | 2026-08-15 01:11:01 | 0 | |
|
pYCTK022 Resource Report Resource Website |
RRID:Addgene_176726 | ste2Kl | Kluyveromyces lactis | Chloramphenicol | The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint. | Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | Codon-optimized for expression in S. cerevisiae | 2026-08-15 01:11:01 | 0 | |
|
pYCTK024 Resource Report Resource Website |
RRID:Addgene_176728 | ste2Lf | Lachancea fermentati | Chloramphenicol | The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint. | Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | Codon-optimized for expression in S. cerevisiae | 2026-08-15 01:11:01 | 0 | |
|
pYCTK018 Resource Report Resource Website |
RRID:Addgene_176722 | mfalpha1Vp | Vanderwaltozyma polyspora | Chloramphenicol | The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint. | Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | Codon-optimized for expression in S. cerevisiae | 2026-08-15 01:11:01 | 0 | |
|
pYCTK009 Resource Report Resource Website |
RRID:Addgene_176713 | mfalpha1Ec | Eremothecium cymbalariae | Chloramphenicol | The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint. | Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol | Codon-optimized for expression in S. cerevisiae | 2026-08-15 01:11:01 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.