Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
RF17 Resource Report Resource Website |
RRID:Addgene_102801 | none | None | PMID:33289521 | This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB ilvE Precursor strain = RF4 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Phe, Ile, Leu Please note- RF17 strain has knockouts in aspC, tyrB, and ilvE genes and requires the presence of L-Asp, L-Tyr, L-Phe, L-Ile plus L-Leu for (slow) growth in M63 minimal medium. Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:18:30 | 0 | ||
|
LC-E75 Resource Report Resource Website 1+ mentions |
RRID:Addgene_115925 | none | None | PMID:29765036 | E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-mCherry Integration at primary 186 attB: pOSIP-CO-RBS-librarydCas9 (2-3)* *Number in parentheses refers to the selected colony number. mCherry quantifies dCas9 repression | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:20:27 | 3 | ||
|
FD1 Resource Report Resource Website |
RRID:Addgene_125258 | single chromosomal copy of yhhX target sequence upstream from mcherry reporter gene under control of a constitutive promoter | None | PMID:31377338 | Genotype: The expression of mcherry can be visualized or measured with a spectrophotometer. The yhhX target sequence followed by a mcherry reporter gene carried by an integrative vector based on pOSIP-KL was integrated at the lambda attB site in the chromosome of E. coli MG1655 and the backbone was flipped out using the pE-FLP (AmpR, #45978, Addgene) plasmid. This strain can be used to optimize dCas9 expression levels | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:22:11 | 0 | ||
|
BL21 ΔrecB Resource Report Resource Website |
RRID:Addgene_176580 | Strain | None | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recB deletion verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None | recB genomic deletion | Addgene | 2026-09-26 02:28:59 | 0 | |
|
Top10∆serB Resource Report Resource Website |
RRID:Addgene_34928 | None | PMID:21868676 | To prevent possible enzymatic dephosphorylation of O-phospho-L-serine (Sep) in vivo, the gene encoding phosphoserine phosphatase (serB), which catalyzes the last step in serine biosynthesis, was deleted from Escherichia coli strain Top10. Markerless gene deletions were carried out using a λ-red and FLP recombinase-based gene knockout strategy. | Vector Backbone:None; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:31:58 | 0 | |||
|
EcAR7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_52055 | None | None | PMID:22982858 | We recommend growth of the EcAR7 strain at 30 °C in LB supplemented with 0.08% glucose. The EcAR7 strains normally take 1.5-‐2 days to grow at 30°C, after transformation or streaking the strain on an agar plate (with the appropriate antibiotics). See supplemental information from referenced article for protocol on creating EcAR7 from EcNR2. | Vector Backbone:None; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:29 | 5 | ||
|
Oplac2 (37)-KI Resource Report Resource Website |
RRID:Addgene_52702 | Oplac2 (37)-KI strain | None | PMID:22605776 | To test whether the mRNA secondary structure of our codon redesigned sequences affected expression, we substituted the first 37 nucleotides of KIlac with those of OpLac2. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:35 | 0 | ||
|
delta-YA Resource Report Resource Website |
RRID:Addgene_52708 | ΔYA strain | None | PMID:22605776 | lacY and lacA deletion | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:35 | 0 | ||
|
delta-ZA Resource Report Resource Website |
RRID:Addgene_52707 | ΔZA strain | None | PMID:22605776 | lacZ and lacA deletion | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:35 | 0 | ||
|
W999L Resource Report Resource Website |
RRID:Addgene_52713 | W999L strain | None | PMID:22605776 | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:35 | 0 | |||
|
E537Q Resource Report Resource Website |
RRID:Addgene_52714 | E537Q strain | None | PMID:22605776 | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:35 | 0 | |||
|
G794A Resource Report Resource Website |
RRID:Addgene_52711 | G794A strain | None | PMID:22605776 | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:35 | 0 | |||
|
W999F Resource Report Resource Website |
RRID:Addgene_52712 | W999F strain | None | PMID:22605776 | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:35 | 0 | |||
|
delta-ZYA Resource Report Resource Website |
RRID:Addgene_52695 | ΔZYA strain | None | PMID:22605776 | MG1655 was transformed with pKD46 (carrying phage lambda Red recombinase) and a PCR fragment encoding a kanamycin resistance gene with flanking nucleotide sequences homologous to those flanking the lac operon. Upon recombination and selection for resistant strains, the kanamycin-resistant gene was eliminated following transformation with pCP20 (encoding the FLP recombinase), which is subsequently cured by growth at 30°C. The deletion in our ΔZYA strain started 20bp upstream of lacI and ran 40bp downstream of lacA. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:35 | 0 | ||
|
OpLac1-delta-6 Resource Report Resource Website |
RRID:Addgene_52698 | OpLac1-Δ6 strain | None | PMID:22605776 | Oplac1Δ6 were erroneously synthesized missing the first 6 nucleotides of Oplac1. These deletions correspond to the first 2 N-terminal amino acid residues (Methionine and Threonine), and instead begin at the Methionine at position 3. | Vector Backbone:na; Vector Types:; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:35 | 0 | ||
|
HL 1285 Resource Report Resource Website |
RRID:Addgene_52942 | none | E.coli | None | PMID:25087841 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:36 | 0 | ||
|
HL3721 Resource Report Resource Website |
RRID:Addgene_52950 | none | E.coli | None | PMID:23878244 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | Addgene | 2026-09-26 02:34:36 | 0 | ||
|
HL 716 Resource Report Resource Website |
RRID:Addgene_60368 | See comments | None | PMID:21189298 | MG1655 + lacIq integrated at intS | Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None | Addgene | 2026-09-26 02:35:45 | 0 | ||
|
HL 770 Resource Report Resource Website |
RRID:Addgene_60369 | See comments | None | PMID:21189298 | MG1655 + lacIq intergrated at intS + Δ hfq | Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None | Addgene | 2026-09-26 02:35:45 | 0 | ||
|
HL 1188 Resource Report Resource Website |
RRID:Addgene_60373 | See comments | None | PMID:21189298 | MG1655 + lacIq intergrated at intS + Δ hfq + Δ dsrA | Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None | Addgene | 2026-09-26 02:35:45 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
