Plasmids   Select Another Resource Report Type

http://www.addgene.org/102801

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:33289521
Comments: This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB ilvE Precursor strain = RF4 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Phe, Ile, Leu Please note- RF17 strain has knockouts in aspC, tyrB, and ilvE genes and requires the presence of L-Asp, L-Tyr, L-Phe, L-Ile plus L-Leu for (slow) growth in M63 minimal medium. Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378.

Proper citation: RRID:Addgene_102801 Copy   

•   Source: Addgene
  

http://www.addgene.org/115925

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29765036
Comments: E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-mCherry Integration at primary 186 attB: pOSIP-CO-RBS-librarydCas9 (2-3)* *Number in parentheses refers to the selected colony number. mCherry quantifies dCas9 repression

Proper citation: RRID:Addgene_115925 Copy   

•   Source: Addgene
  

http://www.addgene.org/125258

Genetic Insert: single chromosomal copy of yhhX target sequence upstream from mcherry reporter gene under control of a constitutive promoter
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:31377338
Comments: Genotype: The expression of mcherry can be visualized or measured with a spectrophotometer. The yhhX target sequence followed by a mcherry reporter gene carried by an integrative vector based on pOSIP-KL was integrated at the lambda attB site in the chromosome of E. coli MG1655 and the backbone was flipped out using the pE-FLP (AmpR, #45978, Addgene) plasmid. This strain can be used to optimize dCas9 expression levels

Proper citation: RRID:Addgene_125258 Copy   

•   Source: Addgene
  

http://www.addgene.org/176580

Genetic Insert: Strain
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recB deletion verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag

Proper citation: RRID:Addgene_176580 Copy   

•   Source: Addgene
  

http://www.addgene.org/34928

Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:21868676
Comments: To prevent possible enzymatic dephosphorylation of O-phospho-L-serine (Sep) in vivo, the gene encoding phosphoserine phosphatase (serB), which catalyzes the last step in serine biosynthesis, was deleted from Escherichia coli strain Top10. Markerless gene deletions were carried out using a λ-red and FLP recombinase-based gene knockout strategy.

Proper citation: RRID:Addgene_34928 Copy   

•   Source: Addgene
  

http://www.addgene.org/52055

Genetic Insert: None
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22982858
Comments: We recommend growth of the EcAR7 strain at 30 °C in LB supplemented with 0.08% glucose. The EcAR7 strains normally take 1.5-­‐2 days to grow at 30°C, after transformation or streaking the strain on an agar plate (with the appropriate antibiotics). See supplemental information from referenced article for protocol on creating EcAR7 from EcNR2.

Proper citation: RRID:Addgene_52055 Copy   

•   Source: Addgene
  

http://www.addgene.org/52702

Genetic Insert: Oplac2 (37)-KI strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: To test whether the mRNA secondary structure of our codon redesigned sequences affected expression, we substituted the first 37 nucleotides of KIlac with those of OpLac2.

Proper citation: RRID:Addgene_52702 Copy   

•   Source: Addgene
  

http://www.addgene.org/52708

Genetic Insert: ΔYA strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: lacY and lacA deletion

Proper citation: RRID:Addgene_52708 Copy   

•   Source: Addgene
  

http://www.addgene.org/52707

Genetic Insert: ΔZA strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: lacZ and lacA deletion

Proper citation: RRID:Addgene_52707 Copy   

•   Source: Addgene
  

http://www.addgene.org/52713

Genetic Insert: W999L strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776

Proper citation: RRID:Addgene_52713 Copy   

•   Source: Addgene
  

http://www.addgene.org/52714

Genetic Insert: E537Q strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776

Proper citation: RRID:Addgene_52714 Copy   

•   Source: Addgene
  

http://www.addgene.org/52711

Genetic Insert: G794A strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776

Proper citation: RRID:Addgene_52711 Copy   

•   Source: Addgene
  

http://www.addgene.org/52712

Genetic Insert: W999F strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776

Proper citation: RRID:Addgene_52712 Copy   

•   Source: Addgene
  

http://www.addgene.org/52695

Genetic Insert: ΔZYA strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: MG1655 was transformed with pKD46 (carrying phage lambda Red recombinase) and a PCR fragment encoding a kanamycin resistance gene with flanking nucleotide sequences homologous to those flanking the lac operon. Upon recombination and selection for resistant strains, the kanamycin-resistant gene was eliminated following transformation with pCP20 (encoding the FLP recombinase), which is subsequently cured by growth at 30°C. The deletion in our ΔZYA strain started 20bp upstream of lacI and ran 40bp downstream of lacA.

Proper citation: RRID:Addgene_52695 Copy   

•   Source: Addgene
  

http://www.addgene.org/52698

Genetic Insert: OpLac1-Δ6 strain
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: Oplac1Δ6 were erroneously synthesized missing the first 6 nucleotides of Oplac1. These deletions correspond to the first 2 N-terminal amino acid residues (Methionine and Threonine), and instead begin at the Methionine at position 3.

Proper citation: RRID:Addgene_52698 Copy   

•   Source: Addgene
  

http://www.addgene.org/52942

Species: E.coli
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:25087841

Proper citation: RRID:Addgene_52942 Copy   

•   Source: Addgene
  

http://www.addgene.org/52950

Species: E.coli
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:23878244

Proper citation: RRID:Addgene_52950 Copy   

•   Source: Addgene
  

http://www.addgene.org/60368

Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:21189298
Comments: MG1655 + lacIq integrated at intS

Proper citation: RRID:Addgene_60368 Copy   

•   Source: Addgene
  

http://www.addgene.org/60369

Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:21189298
Comments: MG1655 + lacIq intergrated at intS + Δ hfq

Proper citation: RRID:Addgene_60369 Copy   

•   Source: Addgene
  

http://www.addgene.org/60373

Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:21189298
Comments: MG1655 + lacIq intergrated at intS + Δ hfq + Δ dsrA

Proper citation: RRID:Addgene_60373 Copy   

•   Source: Addgene