Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: CREST
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_22963 Copy
Species: Rattus norvegicus
Genetic Insert: LMO4
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_22964 Copy
Species: Rattus norvegicus
Genetic Insert: CREST
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pRK5-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_22960 Copy
Species: Rattus norvegicus
Genetic Insert: CREB
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12718894
Comments: GAL4 DNA-binding domain fused N-terminally to full-length CREB cDNA (aa 4-341)
Proper citation: RRID:Addgene_22973 Copy
Species: Rattus norvegicus
Genetic Insert: GluR1
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pSIN; Vector Types:Sindbis virus production; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19543281
Proper citation: RRID:Addgene_24004 Copy
Species: Rattus norvegicus
Genetic Insert: ARMS
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11150334
Comments: pFLAG-ARMS was generated by ligating two fragments of ARMS- HindIII/KpnI and KpnI/SpeI-- into the HindIII and XbaI sites of pFLAG. The HindIII site was generated by PCR;note that the SpeI and Xba I sites no longer exist after the ligation.
Proper citation: RRID:Addgene_24086 Copy
Species: Rattus norvegicus
Genetic Insert: TrkB
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11157096
Proper citation: RRID:Addgene_24088 Copy
Species: Rattus norvegicus
Genetic Insert: TrkC
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11157096
Proper citation: RRID:Addgene_24089 Copy
Species: Rattus norvegicus
Genetic Insert: TrkA
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pDSRed2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_24093 Copy
Species: Rattus norvegicus
Genetic Insert: TrkC
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_24094 Copy
Species: Rattus norvegicus
Genetic Insert: Glucocorticoid Receptor
Vector Backbone Description: Backbone Size:7650; Vector Backbone:pLentiLox 3.7; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18347336
Comments: We designed an shRNA targeting the rat GR sequence in the pLentiLox3.7 (ATCC) plasmid carrying a GFP reporter: forward sequence, 5′-tgcgggagaagatgatccattcttcaagagagaatggatcatcttctcccgcttttttgaattc; reverse sequence, 5′-tcgagaattcaaaaaagcgggagaagatgatccattctctcttgaagaatggatcatcttctcccgca.
Proper citation: RRID:Addgene_24095 Copy
Species: Rattus norvegicus
Genetic Insert: NR1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16481433
Comments: The super-ecliptic pHluorin (SEP) coding sequence was inserted three amino acids downstream of the predicted signal peptide cleavage site.
Proper citation: RRID:Addgene_23999 Copy
Species: Rattus norvegicus
Genetic Insert: NR2A
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16481433
Comments: See attached map for additional plasmid features.
The super-ecliptic pHluorin (SEP) coding sequence was inserted three amino acids downstream of the predicted signal peptide cleavage site.
Proper citation: RRID:Addgene_23997 Copy
Species: Rattus norvegicus
Genetic Insert: NR2B
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16481433
Comments: See attached map for additional plasmid features.
The super-ecliptic pHluorin (SEP) coding sequence was inserted three amino acids downstream of the predicted signal peptide cleavage site.
Proper citation: RRID:Addgene_23998 Copy
Species: Rattus norvegicus
Genetic Insert: Pit1
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pRSV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2284007
Proper citation: RRID:Addgene_24059 Copy
Species: Rattus norvegicus
Genetic Insert: Erk2
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11352917
Proper citation: RRID:Addgene_39222 Copy
Species: Rattus norvegicus
Genetic Insert: TrkB.T1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pRC/CMV AC7 vector, a derivative of the pRC/CMV vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9927421
Comments: The T1 isoform of trkB was cloned from a pCMV-5 trkB.T1 construct using HindIII and XbaI to fuse it to the HA-tagged N-terminus of trkB in the vector pB-KS followed by subcloning into pRC/CMV AC7 with NheI and NotI.
See Middlemas et al (Mol Cell Biol. 1991 Jan;11(1):143-53., https://www.ncbi.nlm.nih.gov/pubmed?term=1846020 ) to learn more about the TrkB.T1 variant.
Please note that the endogenous signal sequence of TrkB-T1 was replaced by the BM40 signal peptide sequence (MRAWIFFLLCLAGRALAAPLA). When compared to translated sequences for GenBank ID M55292.1 or NM_001163168.1, the TrkB-T1 protein sequence starts at amino acid #32
Proper citation: RRID:Addgene_39980 Copy
Species: Rattus norvegicus
Genetic Insert: TrkC
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pRC/CMV AC7 vector, a derivative of the pRC/CMV vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9927421
Comments: cloned in the pRC/CMV AC7 vector, a derivative of the pRC/CMV vector (Invitrogen), which contains the BM40 signal peptide
Please note that the endogenous signal sequence of TrkC was replaced by the BM40 signal peptide sequence (MRAWIFFLLCLAGRALAAPLA). When compared to translated sequence for GenBank ID NM_001270656.1, the TrkC protein sequence starts at amino acid #32
Proper citation: RRID:Addgene_39979 Copy
Species: Rattus norvegicus
Genetic Insert: TrkA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pRC/CMV AC7 vector, a derivative of the pRC/CMV vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9927421
Comments: cloned in the pRC/CMV AC7 vector, a derivative of the pRC/CMV vector (Invitrogen), which contains the BM40 signal peptide
Please note that the endogenous signal sequence of TrkA was replaced by the BM40 signal peptide sequence (MRAWIFFLLCLAGRALAAPLA). When compared to GenBank ID NP_067600.1, the TrkA protein sequence starts at amino acid #30
Proper citation: RRID:Addgene_39977 Copy
Species: Rattus norvegicus
Genetic Insert: SAPAP4
Vector Backbone Description: Vector Backbone:pCMV5 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9115257
Proper citation: RRID:Addgene_40218 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
