Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pFYF1327 EGFP Site#2 Resource Report Resource Website |
RRID:Addgene_47512 | gRNA-EGFP site 2 | Synthetic | Ampicillin | PMID:23792628 | Target site: GATGCCGTTCTTCTGCTTGT gRNA expression vector targeting EGFP for use with JDS246 (Addgene plasmid# 43861--mammalian codon-optimized streptococcus pyogenes Cas9) | Backbone Marker:Joung lab (Addgene plasmid #43860); Backbone Size:2278; Vector Backbone:MLM3636; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:43 | 0 | |
|
LITE2.0_pAAV_hSyn_TALE(Grm2)-GS-CIB1(NLS*,∆318-334)_WPRE_bGHpA Resource Report Resource Website |
RRID:Addgene_47456 | TALE(Grm2)-GS-CIB1(NLS*,∆318-334) | Synthetic | Ampicillin | PMID:23877069 | Backbone Marker:Zhang Lab; Backbone Size:4280; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV, TALE; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:41 | 0 | ||
|
LITE2.0 pAAV_hSyn_NLS(alpha-imp)-CRY2PHR-NLS-VP64_2A_GFP_WPRE_bGHpA Resource Report Resource Website 1+ mentions |
RRID:Addgene_47455 | NLS(alpha-imp)-CRY2PHR-NLS-VP64 | Synthetic | Ampicillin | PMID:23877069 | Backbone Marker:Zhang Lab; Backbone Size:4280; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:41 | 1 | ||
|
pAAV_hSyn_TALEBB(HD)-NLS-VP64_2A_GFP_WPRE_bGHpA Resource Report Resource Website |
RRID:Addgene_47446 | TALE BB(N136_0.5HD_C63)-VP64 | Synthetic | Ampicillin | PMID:23877069 | Backbone Marker:Zhang Lab; Backbone Size:4281; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV, TALE; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:41 | 0 | ||
|
pAAV_hSyn_TALEBB(NN)-NLS-SID4X_2A_phiLOV2.1_WPRE_bGHpA Resource Report Resource Website |
RRID:Addgene_47449 | TALE BB(N136_0.5NN_C63)-SID4X | Synthetic | Ampicillin | PMID:23877069 | Backbone Marker:Zhang Lab; Backbone Size:4281; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV, TALE; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:41 | 0 | ||
|
pAAV_hSyn_TALEBB(NI)-NLS-VP64_2A_GFP_WPRE_bGHpA Resource Report Resource Website |
RRID:Addgene_47448 | TALE BB(N136_0.5NI_C63)-VP64 | Synthetic | Ampicillin | PMID:23877069 | Backbone Marker:Zhang Lab; Backbone Size:4281; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV, TALE; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:42 | 0 | ||
|
pJ251-GERC Resource Report Resource Website 1+ mentions |
RRID:Addgene_47441 | Gene Expression Reporter Construct | Synthetic | Kanamycin | Backbone Marker:DNA2.0; Backbone Size:2628; Vector Backbone:pJ251; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:41 | 8 | |||
|
pGEM-mcpGFP Resource Report Resource Website |
RRID:Addgene_47442 | mcpGFP | Synthetic | Ampicillin | PMID:23840931 | same as Tian L, Hires SA, Mao T, Huber D, Chiappe ME, Chalasani SH, et al. 2009. Imaging neural activity in worms, flies and mice with improved GCaMP calcium indicators. Nat Methods 6:875–81. doi: 10.1038/nmeth.1398. | Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pGEM T-easy; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | M154K, V164A, S176G, D181Y, T204V, A207K, V190I | 2026-08-15 01:15:42 | 0 |
|
pDD122 (Peft-3::Cas9 + ttTi5605 sgRNA) Resource Report Resource Website 1+ mentions |
RRID:Addgene_47550 | Cas9 | Synthetic | Ampicillin | PMID:23995389 | For more information on Goldstein Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Goldstein/ gRNA target sequence atatcagtctgtttcgtaa Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 | Backbone Size:2300; Vector Backbone:pCFJ601; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | Codon optimized and with synthetic introns for C. elegans | 2026-08-15 01:15:43 | 9 |
|
MSP1-bio Resource Report Resource Website 1+ mentions |
RRID:Addgene_47709 | Codon-optimised MSP1 | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine123, Threonine262, Threonine491, Serine557, Serine628, Serine823, Threonine835, Threonine920, Serine940, Threonine986, Threonine1012, Serine1110, Threonine1217, Serine1609 to Alanine residues | 2026-08-15 01:15:43 | 3 | |
|
P12p-bio Resource Report Resource Website |
RRID:Addgene_47726 | Codon-optimised P12p | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Threonine186, Threonine244 and Threonine248 to Alanine residues | 2026-08-15 01:15:44 | 0 | |
|
P38-bio Resource Report Resource Website |
RRID:Addgene_47727 | Codon-optimised P38 | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine176, Threonine296, Serine297 and Threonine303 to Alanine residues | 2026-08-15 01:15:43 | 0 | |
|
P12-bio Resource Report Resource Website |
RRID:Addgene_47725 | Codon-optimised P12 | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Threonine30, Threonine56, Serine149, Serine202, Serine230, Serine244, Threonine267 to Alanine residues | 2026-08-15 01:15:43 | 0 | |
|
MSP5-bio Resource Report Resource Website |
RRID:Addgene_47718 | Codon-optimised MSP5 | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine80, Serine99, Serine123 and Threonine194 to Alanine residues | 2026-08-15 01:15:44 | 0 | |
|
pFAB3996 Resource Report Resource Website |
RRID:Addgene_47827 | promoter 14 and BCD20 | Synthetic | Kanamycin | PMID:23474465 | http://biofab.org/services RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 66.03 | Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:44 | 0 | |
|
pFAB3997 Resource Report Resource Website |
RRID:Addgene_47828 | promoter 14 and BCD21 | Synthetic | Kanamycin | PMID:23474465 | http://biofab.org/services RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 51.15 | Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:44 | 0 | |
|
pFAB3998 Resource Report Resource Website |
RRID:Addgene_47829 | promoter 14 and BCD22 | Synthetic | Kanamycin | PMID:23474465 | http://biofab.org/services RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 10.19 | Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:46 | 0 | |
|
RAMA-bio Resource Report Resource Website |
RRID:Addgene_47786 | Codon-optimised RAMA | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine54, Threonine399, Threonine404, Serine405, Serine497, Serine577, Serine664, Threonine673, Threonine689 and Serine723 to Alanine residues | 2026-08-15 01:15:45 | 0 | |
|
TLP-bio Resource Report Resource Website |
RRID:Addgene_47787 | Codon-optimised TLP | Synthetic | Ampicillin | PMID:24043421 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Exogenous signal peptide of mouse origin, changed Serine79, Serine112, Serine113, Serine188, Serine247, Serine324, Threonine350, Serine379, Serine394, Threonine459, Serine514, Serine532, Threonine632, Serine642, Serine780, Serine809, Serine889, Serine896, Threonine897, Threonine909, Serine1068, Serine1111, Serine1114, Serine1151, Threonine1244, Threonine1272 and Serine1304 to Alanine residues | 2026-08-15 01:15:44 | 0 | |
|
pFAB3989 Resource Report Resource Website |
RRID:Addgene_47820 | promoter 14 and BCD13 | Synthetic | Kanamycin | PMID:23474465 | http://biofab.org/services RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 96.71 | Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:44 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
