Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: gRNA-EGFP site 2
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid #43860); Backbone Size:2278; Vector Backbone:MLM3636; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23792628
Comments: Target site: GATGCCGTTCTTCTGCTTGT
gRNA expression vector targeting EGFP for use with JDS246 (Addgene plasmid# 43861--mammalian codon-optimized streptococcus pyogenes Cas9)
Proper citation: RRID:Addgene_47512 Copy
Species: Synthetic
Genetic Insert: TALE(Grm2)-GS-CIB1(NLS*,∆318-334)
Vector Backbone Description: Backbone Marker:Zhang Lab; Backbone Size:4280; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV, TALE; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23877069
Proper citation: RRID:Addgene_47456 Copy
Species: Synthetic
Genetic Insert: NLS(alpha-imp)-CRY2PHR-NLS-VP64
Vector Backbone Description: Backbone Marker:Zhang Lab; Backbone Size:4280; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23877069
Proper citation: RRID:Addgene_47455 Copy
Species: Synthetic
Genetic Insert: TALE BB(N136_0.5HD_C63)-VP64
Vector Backbone Description: Backbone Marker:Zhang Lab; Backbone Size:4281; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV, TALE; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23877069
Proper citation: RRID:Addgene_47446 Copy
Species: Synthetic
Genetic Insert: TALE BB(N136_0.5NN_C63)-SID4X
Vector Backbone Description: Backbone Marker:Zhang Lab; Backbone Size:4281; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV, TALE; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23877069
Proper citation: RRID:Addgene_47449 Copy
Species: Synthetic
Genetic Insert: TALE BB(N136_0.5NI_C63)-VP64
Vector Backbone Description: Backbone Marker:Zhang Lab; Backbone Size:4281; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV, TALE; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23877069
Proper citation: RRID:Addgene_47448 Copy
Species: Synthetic
Genetic Insert: Gene Expression Reporter Construct
Vector Backbone Description: Backbone Marker:DNA2.0; Backbone Size:2628; Vector Backbone:pJ251; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_47441 Copy
Species: Synthetic
Genetic Insert: mcpGFP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pGEM T-easy; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23840931
Comments: same as
Tian L, Hires SA, Mao T, Huber D, Chiappe ME, Chalasani SH, et al. 2009. Imaging neural activity in worms, flies
and mice with improved GCaMP calcium indicators. Nat Methods 6:875–81. doi: 10.1038/nmeth.1398.
Proper citation: RRID:Addgene_47442 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:2300; Vector Backbone:pCFJ601; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23995389
Comments: For more information on Goldstein Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Goldstein/
gRNA target sequence atatcagtctgtttcgtaa
Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_47550 Copy
Species: Synthetic
Genetic Insert: Codon-optimised MSP1
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24043421
Proper citation: RRID:Addgene_47709 Copy
Species: Synthetic
Genetic Insert: Codon-optimised P12p
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24043421
Proper citation: RRID:Addgene_47726 Copy
Species: Synthetic
Genetic Insert: Codon-optimised P38
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24043421
Proper citation: RRID:Addgene_47727 Copy
Species: Synthetic
Genetic Insert: Codon-optimised P12
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24043421
Proper citation: RRID:Addgene_47725 Copy
Species: Synthetic
Genetic Insert: Codon-optimised MSP5
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24043421
Proper citation: RRID:Addgene_47718 Copy
Species: Synthetic
Genetic Insert: promoter 14 and BCD20
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: http://biofab.org/services
RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 66.03
Proper citation: RRID:Addgene_47827 Copy
Species: Synthetic
Genetic Insert: promoter 14 and BCD21
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: http://biofab.org/services
RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 51.15
Proper citation: RRID:Addgene_47828 Copy
Species: Synthetic
Genetic Insert: promoter 14 and BCD22
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: http://biofab.org/services
RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 10.19
Proper citation: RRID:Addgene_47829 Copy
Species: Synthetic
Genetic Insert: Codon-optimised RAMA
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24043421
Proper citation: RRID:Addgene_47786 Copy
Species: Synthetic
Genetic Insert: Codon-optimised TLP
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:6633; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24043421
Proper citation: RRID:Addgene_47787 Copy
Species: Synthetic
Genetic Insert: promoter 14 and BCD13
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: http://biofab.org/services
RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 96.71
Proper citation: RRID:Addgene_47820 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.