Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 70 showing 1381 ~ 1400 out of 2,192 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_41363

http://www.addgene.org/41363

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-tac3a-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCATAATCTGTCACTTAC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41363 Copy   


  • RRID:Addgene_41362

http://www.addgene.org/41362

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-tac3a-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCAGCAGTCAGAGTCTCA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41362 Copy   


http://www.addgene.org/41836

Species: Danio rerio
Genetic Insert: protein phosphatase 1, catalytic subunit, alpha isoform b
Vector Backbone Description: Backbone Marker:Dan Carlson (Addgene plasmid# 38142); Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23000899
Comments: The ppp1cab TALEN recognition sequences are: left TALEN 5′-CCACCAGAGAGTAACT-3′ and right TALEN 5′-GCCTCTGTCAACATAGT-3′. Between the two binding sites is a 15-bp spacer containing a BsII site (ACCTATTTCTGGGAG). See Addgene plasmid# 41835 and the associated publication for more information.

Proper citation: RRID:Addgene_41836 Copy   


http://www.addgene.org/41835

Species: Danio rerio
Genetic Insert: protein phosphatase 1, catalytic subunit, alpha isoform b
Vector Backbone Description: Backbone Marker:Dan Carlson (Addgene plasmid# 38142); Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23000899
Comments: The ppp1cab TALEN recognition sequences are: left TALEN 5′-CCACCAGAGAGTAACT-3′ and right TALEN 5′-GCCTCTGTCAACATAGT-3′. Between the two binding sites is a 15-bp spacer containing a BsII site (ACCTATTTCTGGGAG). See Addgene plasmid# 41836 and the associated publication for more information.

Proper citation: RRID:Addgene_41835 Copy   


  • RRID:Addgene_41834

http://www.addgene.org/41834

Species: Danio rerio
Genetic Insert: cadherin 5
Vector Backbone Description: Backbone Marker:Dan Carlson (Addgene plasmid# 38142); Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23000899
Comments: The cdh5 TALEN recognition sequences are: left TALEN 5′-CTCCTCAACATACATACT-3′ and right TALEN 5′-ACAAATGATTCATCTT-3′. Between the two binding sites is a 16-bp spacer containing a HincII site (GGAGAGTTAGTTGACA). See Addgene plasmid# 41833 and the associated publication for more information.

Proper citation: RRID:Addgene_41834 Copy   


http://www.addgene.org/41832

Species: Danio rerio
Genetic Insert: moesin a
Vector Backbone Description: Backbone Marker:Dan Carlson (Addgene plasmid# 38142); Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23000899
Comments: The moesina TALEN recognition sequences are: left TALEN 5′-ACCCAGAAGACGTTT-3′ and right TALEN 5′-CTTTGAGTGGCCTCCT-3′. Between the two binding sites is a 15-bp spacer containing an XmnI site (CTGAGGAACTGATTC). See Addgene plasmid# 41831 and the associated publication for more information.

Proper citation: RRID:Addgene_41832 Copy   


http://www.addgene.org/41831

Species: Danio rerio
Genetic Insert: moesin a
Vector Backbone Description: Backbone Marker:Dan Carlson (Addgene plasmid# 38142); Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23000899
Comments: The moesina TALEN recognition sequences are: left TALEN 5′-ACCCAGAAGACGTTT-3′ and right TALEN 5′-CTTTGAGTGGCCTCCT-3′. Between the two binding sites is a 15-bp spacer containing an XmnI site (CTGAGGAACTGATTC). See Addgene plasmid# 41832 and the associated publication for more information.

Proper citation: RRID:Addgene_41831 Copy   


  • RRID:Addgene_42249

http://www.addgene.org/42249

Species: Danio rerio
Genetic Insert: gRNA-tph1a
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGGAAAACACAACCGCAGCC Guide RNA sequence: TAATACGACTCACTATAGGGAAAACACAACCGCAGCCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA

Proper citation: RRID:Addgene_42249 Copy   


  • RRID:Addgene_42241

http://www.addgene.org/42241

Species: Danio rerio
Genetic Insert: gRNA-apoea
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGATGAGCCAAGAAGCCGCT Guide RNA sequence: TAATACGACTCACTATAGGATGAGCCAAGAAGCCGCTGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA

Proper citation: RRID:Addgene_42241 Copy   


  • RRID:Addgene_42244

http://www.addgene.org/42244

Species: Danio rerio
Genetic Insert: gRNA-fh site #2
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGAGCGAGCGGAGCGGTACA Guide RNA sequence: TAATACGACTCACTATAGGAGCGAGCGGAGCGGTACAGTTTTAGAGCTAGAAATAGCAAGT TAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA

Proper citation: RRID:Addgene_42244 Copy   


  • RRID:Addgene_42245

http://www.addgene.org/42245

Species: Danio rerio
Genetic Insert: gRNA-gsk3b
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGGACCTGACCGGCCGCAGG Guide RNA sequence: TAATACGACTCACTATAGGGACCTGACCGGCCGCAGGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA

Proper citation: RRID:Addgene_42245 Copy   


  • RRID:Addgene_42247

http://www.addgene.org/42247

Species: Danio rerio
Genetic Insert: gRNA-th1
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGATGCGCGTAAGGAGCGCG Guide RNA sequence: TAATACGACTCACTATAGGATGCGCGTAAGGAGCGCGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA

Proper citation: RRID:Addgene_42247 Copy   


  • RRID:Addgene_42299

http://www.addgene.org/42299

Species: Danio rerio
Genetic Insert: EGFP-Rpl10a
Vector Backbone Description: Backbone Size:6140; Vector Backbone:pT2KXIG; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23281262

Proper citation: RRID:Addgene_42299 Copy   


http://www.addgene.org/42654

Species: Danio rerio
Genetic Insert: ponzr1 left pTAL scaffold
Vector Backbone Description: Backbone Marker:Addgene plasmid 38142; Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23000899

Proper citation: RRID:Addgene_42654 Copy   


  • RRID:Addgene_42699

http://www.addgene.org/42699

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-dbx1b-left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCCCGTGCAAGGAATGAA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_42699 Copy   


  • RRID:Addgene_42693

http://www.addgene.org/42693

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-Complement Factor H-left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGATTACATGTGAACCTC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_42693 Copy   


  • RRID:Addgene_42690

http://www.addgene.org/42690

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-CIT1-right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCGACTGCGGACAGATCT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_42690 Copy   


  • RRID:Addgene_42680

http://www.addgene.org/42680

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-atg12-right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCAAAAAGCACACCAACT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_42680 Copy   


  • RRID:Addgene_42681

http://www.addgene.org/42681

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-atg5-left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TAAAGTCAAGAAACATTT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_42681 Copy   


  • RRID:Addgene_42682

http://www.addgene.org/42682

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-atg5-right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TTCCTCCACATCCTCTGC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_42682 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X