Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: P. aeruginosa
Genetic Insert: 3-guanidinopropionase
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This ORF comes from genomic DNA of P. aeruginosa PAO1 strain. The ORF shows a mutation V128A in BLAST results. The mutation may be due to errors in the original genome sequencing.
Proper citation: RRID:Addgene_29793 Copy
Species: P. aeruginosa
Genetic Insert: Guanidinobutyrase
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This ORF comes from genomic DNA of P. aeruginosa PAO1 strain. The ORF shows two mutations V151I and G261S in BLAST results. The mutations may be due to errors in the original genome sequencing.
Proper citation: RRID:Addgene_29792 Copy
Species: P. aeruginosa
Genetic Insert: Guanidinobutyrase
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_29791 Copy
Species: E. coli
Genetic Insert: pLtetO-1:MicC, pLtetO-1:OxyS, pLlacO-1:ompC::gfp
Vector Backbone Description: Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_30022 Copy
Species: E. coli
Genetic Insert: LacZ-5BoxB
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21423168
Proper citation: RRID:Addgene_29729 Copy
Vector Backbone Description: Backbone Size:6088; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.
GFP has a excitation max of 489 nm and an emission max of 510 nm.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'CTCCCACTACCAATGCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with SspI, then gel purify.
When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29725 Copy
Vector Backbone Description: Backbone Size:6088; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.
mCitrine has a excitation max of 515 nm and an emission max of 529 nm.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'CTCCCACTACCAATGCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with SspI, then gel purify.
When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29724 Copy
Vector Backbone Description: Backbone Size:6082; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.
mOrange has a excitation max of 548 nm and an emission max of 562 nm.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'CTCCCACTACCAATGCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with SspI, then gel purify.
When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29723 Copy
Species: E. coli
Genetic Insert: pLtetO-1:mCherry, pLlacO-1:rpoS::gfp
Vector Backbone Description: Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_30014 Copy
Species: H. strain TP009
Genetic Insert: ArchT-tdTomato
Vector Backbone Description: Backbone Marker:Scott Sternson; Backbone Size:6259; Vector Backbone:AAV with CAG promoter; Vector Types:Mammalian Expression, AAV, Adeno-associated virus; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21811444
Comments: PLEASE CONTACT ED BOYDEN ([email protected]) FOR DETAILS ON THIS REAGENT AND FURTHER REAGENTS IN THIS LINE.
Proper citation: RRID:Addgene_29778 Copy
Species: H. strain TP009
Genetic Insert: ArchT-GFP
Vector Backbone Description: Backbone Marker:Scott Sternson; Backbone Size:5451; Vector Backbone:AAV with CAG promoter; Vector Types:Mammalian Expression, AAV, Adeno-associated virus; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21811444
Comments: PLEASE CONTACT ED BOYDEN ([email protected]) FOR DETAILS ON THIS REAGENT AND FURTHER REAGENTS IN THIS LINE.
Proper citation: RRID:Addgene_29777 Copy
Species: E. coli
Genetic Insert: pLtetO-1:MicC-mCherry, pLlacO-1:ompC::gfp
Vector Backbone Description: Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_30019 Copy
Vector Backbone Description: Backbone Size:5481; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This plasmid can be used as a single-expression vector, and it is also compatible with our 2-series polycistronic destination vectors (2D, 2E, and 2Z), if co-expression with other genes is desired.
mCerulean has a excitation max of 435 nm and an emission max of 477 nm.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5' TTTAAGAAGGAGATATAGATC3'
Reverse - 5' GTTGGAGGATGAGAGGATCCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with EcoRV, then gel purify.
When digesting the DNA with T4 polymerase, use dGTP for the insert and dCTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29773 Copy
Vector Backbone Description: Backbone Size:5481; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This plasmid can be used as a single-expression vector, and it is also compatible with our 2-series polycistronic destination vectors (2D, 2E, and 2Z), if co-expression with other genes is desired.
GFP has a excitation max of 489 nm and an emission max of 510 nm.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5' TTTAAGAAGGAGATATAGATC3'
Reverse - 5' GTTGGAGGATGAGAGGATCCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with EcoRV, then gel purify.
When digesting the DNA with T4 polymerase, use dGTP for the insert and dCTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29772 Copy
Vector Backbone Description: Backbone Size:5481; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This plasmid can be used as a single-expression vector, and it is also compatible with our 2-series polycistronic destination vectors (2D, 2E, and 2Z), if co-expression with other genes is desired.
mCitrine has a excitation max of 515 nm and an emission max of 529 nm.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5' TTTAAGAAGGAGATATAGATC3'
Reverse - 5' GTTGGAGGATGAGAGGATCCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with EcoRV, then gel purify.
When digesting the DNA with T4 polymerase, use dGTP for the insert and dCTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29771 Copy
Species: H. pylori
Genetic Insert: hp0421
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_29790 Copy
Species: E. coli
Genetic Insert: pLtetO-1:DsrA, pLlacO-1:hfq, pLtetO-1:rpoS::gfp
Vector Backbone Description: Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_30085 Copy
Species: E. coli
Genetic Insert: pLtetO-1:RhyB-mCherry, pLlacO-1:ompC::gfp
Vector Backbone Description: Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_30082 Copy
Species: E. coli
Genetic Insert: pLtetO-1:MicC, pLlacO-1:hfq, pLtetO-1:ompC::gfp
Vector Backbone Description: Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_30084 Copy
Species: E. coli
Genetic Insert: pLtetO-1:DsrA-mCherry, pLlacO-1:ompC::gfp
Vector Backbone Description: Backbone Marker:Lim Lab (modified from Rolf Lutz and Hermann Bujard, 1997); Backbone Size:2000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_30083 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
