Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: mSpyCatcher
Vector Backbone Description: Backbone Size:2676; Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28230977
Proper citation: RRID:Addgene_87374 Copy
Species: Groundwater metagenome
Genetic Insert: CasY1
Vector Backbone Description: Vector Backbone:p15A; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28005056
Proper citation: RRID:Addgene_87687 Copy
Species: Deltaproteobacteria
Genetic Insert: CasX1
Vector Backbone Description: Vector Backbone:p15A; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28005056
Proper citation: RRID:Addgene_87685 Copy
Species: Escherichia coli
Genetic Insert: rpsA
Vector Backbone Description: Backbone Size:4520; Vector Backbone:pCA24N; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31832686
Proper citation: RRID:Addgene_83585 Copy
Species: E. coli
Genetic Insert: Gro EL/ES
Vector Backbone Description: Backbone Marker:EMD Millipore; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:23220215
Proper citation: RRID:Addgene_83923 Copy
Species: Streptococcus pyogenes
Genetic Insert: Cas9, tracrRNA, crRNA
Vector Backbone Description: Vector Backbone:Custom pR1162-CmR; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25240928
Proper citation: RRID:Addgene_61271 Copy
Species: E. coli
Genetic Insert: SCRIBE_kanR(ON)
Vector Backbone Description: Backbone Marker:Expressys; Vector Backbone:pZE32; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25395541
Proper citation: RRID:Addgene_61450 Copy
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:21925267
Comments: Genotype = cyo ilvE avtA aspC hisG argH metA lysA
Precursor strain = ML31
Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His, Arg, Met, Lys
ML40(K1) contains an extra pACYC plasmid carrying the cat cassette plus extra tRNA genes (argU, ileY, leuW) from Agilent Technologies Inc.
*In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)].
#In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)].
Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system.
Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.
Proper citation: RRID:Addgene_61920 Copy
Vector Backbone Description: Backbone Marker:Bacillus Genetic Stock Center; Backbone Size:4217; Vector Backbone:pNW33N; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:22578246
Proper citation: RRID:Addgene_61805 Copy
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium; Backbone Size:8362; Vector Backbone:pACYC-LIC+; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Proper citation: RRID:Addgene_62329 Copy
Genetic Insert: Cas9 nuclease
Vector Backbone Description: Vector Backbone:pdCas9-bacteria; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:26463009
Comments: Please note that this plasmid runs as a dimer (>13kb). While this may reduce DNA yield, the plasmid still functions as expected.
Proper citation: RRID:Addgene_62655 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27982027
Comments: The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201)
Proper citation: RRID:Addgene_80859 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27982027
Comments: The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201)
Proper citation: RRID:Addgene_80914 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27982027
Comments: The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201)
Proper citation: RRID:Addgene_80913 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27982027
Comments: The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201)
Proper citation: RRID:Addgene_80912 Copy
Species: Mus musculus
Genetic Insert: TET1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4008; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:26932196
Proper citation: RRID:Addgene_81056 Copy
Species: E. coli, B. subtilis
Genetic Insert: Encodes the hybrid receptor of E. coli chemoreceptor Tar and B. subtilis chemoreceptor McpC: Tar[1-43]-McpC[49-270]-Tar[184-553]
Vector Backbone Description: Backbone Size:4211; Vector Backbone:pKG116; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27285081
Proper citation: RRID:Addgene_81227 Copy
Species: Desulfovibrio vulgaris str. Hildenborough
Genetic Insert: Synthetic CRISPR array (3 copies of D. vulgaris spacer #2 flanked by repeats)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4008; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27588603
Comments: Spacer sequence: GCCATGCTCAGGCTGGCGAGTGCGCCACTCATCAA
Repeat sequence: GTCGCCCCCCACGCGGGGGCGTGGATTGAAAC
Proper citation: RRID:Addgene_81186 Copy
Species: Synthetic
Genetic Insert: TEM-1 beta-lactamase
Vector Backbone Description: Backbone Size:3224; Vector Backbone:pSALECT; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28196882
Proper citation: RRID:Addgene_81163 Copy
Species: E. coli
Genetic Insert: Encodes the hybrid receptor of E. coli chemoreceptor Tar and histidine kinase CitA: CitA[1-193]-Tar[204-553]
Vector Backbone Description: Backbone Size:4211; Vector Backbone:pKG116; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:27285081
Proper citation: RRID:Addgene_82037 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
