Plasmids   Select Another Resource Report Type

http://www.addgene.org/60974

Species: Synthetic
Genetic Insert: ddRFP A-WW domain-ERK substrate-ddFP B
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25622108

Proper citation: RRID:Addgene_60974 Copy   

•   Source: Addgene

http://www.addgene.org/60861

Species: Homo sapiens
Genetic Insert: MYT1L
Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:8465; Vector Backbone:N106; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25374357

Proper citation: RRID:Addgene_60861 Copy   

•   Source: Addgene

http://www.addgene.org/60900

Vector Backbone Description: Backbone Size:8506; Vector Backbone:pUC ori vector; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27030102
Comments: The gRNA cloning strategy is exactly the same as for pX330/pX335.

Proper citation: RRID:Addgene_60900 Copy   

•   Source: Addgene

http://www.addgene.org/60904

Genetic Insert: scFv-GCN4
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25307933
Comments: For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html Note this plasmid was used with the CRISPRa library, as described in Gilbert et al. Cell 2014 PubMed ID: 25307932.

Proper citation: RRID:Addgene_60904 Copy   

•   Source: Addgene

http://www.addgene.org/60903

Genetic Insert: Cas9 dead
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25307933
Comments: For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html Note this plasmid was used with the CRISPRa library, as described in Gilbert et al. Cell 2014 PubMed ID: 25307932.

Proper citation: RRID:Addgene_60903 Copy   

•   Source: Addgene

http://www.addgene.org/60901

Vector Backbone Description: Backbone Size:9070; Vector Backbone:pUC ori vector; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27030102
Comments: The gRNA cloning strategy is exactly the same as for pX330/pX335.

Proper citation: RRID:Addgene_60901 Copy   

•   Source: Addgene

http://www.addgene.org/60907

Genetic Insert: scFv-GCN4
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25307933
Comments: For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html

Proper citation: RRID:Addgene_60907 Copy   

•   Source: Addgene

http://www.addgene.org/60906

Genetic Insert: scFv-GCN4
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25307933
Comments: For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html

Proper citation: RRID:Addgene_60906 Copy   

•   Source: Addgene

http://www.addgene.org/60905

Genetic Insert: BFP
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25307933
Comments: For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html

Proper citation: RRID:Addgene_60905 Copy   

•   Source: Addgene

http://www.addgene.org/60910

Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25307933
Comments: For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html

Proper citation: RRID:Addgene_60910 Copy   

•   Source: Addgene

http://www.addgene.org/60914

Genetic Insert: mito-mCherry
Vector Backbone Description: Vector Backbone:pcDNA4TO; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25307933
Comments: For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html

Proper citation: RRID:Addgene_60914 Copy   

•   Source: Addgene

http://www.addgene.org/60913

Genetic Insert: mito-mCherry
Vector Backbone Description: Vector Backbone:pcDNA4TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25307933
Comments: For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html

Proper citation: RRID:Addgene_60913 Copy   

•   Source: Addgene

http://www.addgene.org/60916

Genetic Insert: AAVS1-ZFNL
Vector Backbone Description: Vector Backbone:PUC18; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25630922

Proper citation: RRID:Addgene_60916 Copy   

•   Source: Addgene

http://www.addgene.org/60909

Genetic Insert: K560-E236A
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA4TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25307933
Comments: For more information, visit https://valelab4.ucsf.edu/external/research/suntag.html

Proper citation: RRID:Addgene_60909 Copy   

•   Source: Addgene

http://www.addgene.org/60991

Species: Synthetic
Genetic Insert: mKate2
Vector Backbone Description: Vector Backbone:pMTB; Vector Types:Zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26010570
Comments: Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region.

Proper citation: RRID:Addgene_60991 Copy   

•   Source: Addgene

http://www.addgene.org/61051

Species: Synthetic
Genetic Insert: EGFP sgRNA
Vector Backbone Description: Backbone Marker:Joung Lab, Addgene plasmid # 42250; Vector Backbone:DR274; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24179142
Comments: eGFP sgRNA = GGCGAGGGCGATGCCACCTA

Proper citation: RRID:Addgene_61051 Copy   

•   Source: Addgene

http://www.addgene.org/61056

Genetic Insert: sfGFP-24xGCN4_v1 peptide array
Vector Backbone Description: Vector Backbone:pcDNA4TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25307933
Comments: For more information, visit http://valelab.ucsf.edu/external/research/suntag.html

Proper citation: RRID:Addgene_61056 Copy   

•   Source: Addgene

http://www.addgene.org/61069

Species: Synthetic
Genetic Insert: eGFPbait
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCRII-TOPO; Vector Types:zebrafish expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:24179142
Comments: The eGFPbait-E2A-KalTA4 donor plasmid was generated by forward insertion of a PCR-amplified eGFP fragment into the pCRII-TOPO vector. Primers used were eGFP_fwd: ATAGTGGTACCATGGTGAGCAAGGGCGAGGAGC, and eGFP_rev: GTAGCGGCTGAAGCACTGCACGC. The E2A-KalTA4-pA fragment was generated by fusion of individual PCR products using Phusion High-Fidelity DNA Polymerase (Thermo Scientific); E2A was amplified with the primers E2A_fwd: TGCAGATATCCAGGAGGAGGACAGTGTACTAATTATGCTC, E2A_rev: TTCCTCCTCCGGGACCTGGGTTGCTC from a previously generated E2A sequence (Szymczak et al. 2004, PMID 15064769). KalTA4-pA was amplified with KalTA4_fwd: CCCAGGTCCCGGAGGAGGAAAACTGCTC, KalTA4_rev: CATGCTCGAGTCCACTAGTTCTAGAGCG, using the 4 × Kaloop vector as template (Distel et al. 2009, PMID 19628697). Subsequently, both fragments were fused, amplified, and inserted into pCRII-TOPO-eGFPbait with EcoRV and XhoI.

Proper citation: RRID:Addgene_61069 Copy   

•   Source: Addgene

http://www.addgene.org/61064

Species: Homo sapiens
Genetic Insert: LMO2
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019369

Proper citation: RRID:Addgene_61064 Copy   

•   Source: Addgene

http://www.addgene.org/61063

Species: Homo sapiens
Genetic Insert: GATA2
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019369

Proper citation: RRID:Addgene_61063 Copy   

•   Source: Addgene