Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:chloramphenicol (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

164,537 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pCG-B-mSpyCatcher-C
 
Resource Report
Resource Website 		RRID:Addgene_87374 mSpyCatcher Chloramphenicol PMID:28230977 Backbone Size:2676; Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-08-15 01:21:43 0
pCasY1
 
Resource Report
Resource Website 		RRID:Addgene_87687 CasY1 Groundwater metagenome Chloramphenicol PMID:28005056 Vector Backbone:p15A; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:21:47 0
pCasX1
 
Resource Report
Resource Website 		RRID:Addgene_87685 CasX1 Deltaproteobacteria Chloramphenicol PMID:28005056 Vector Backbone:p15A; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:21:46 0
pCA24N_6xHis-TEV-rpsA
 
Resource Report
Resource Website 		RRID:Addgene_83585 rpsA Escherichia coli Chloramphenicol PMID:31832686 Backbone Size:4520; Vector Backbone:pCA24N; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:21:10 0
pACYC-GroEL/ES-TF
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_83923 Gro EL/ES E. coli Chloramphenicol PMID:23220215 Backbone Marker:EMD Millipore; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:21:13 1
pMM441
 
Resource Report
Resource Website 		RRID:Addgene_61271 Cas9, tracrRNA, crRNA Streptococcus pyogenes Chloramphenicol PMID:25240928 Vector Backbone:Custom pR1162-CmR; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol 2026-08-15 01:17:40 0
pFF745
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61450 SCRIBE_kanR(ON) E. coli Chloramphenicol PMID:25395541 Backbone Marker:Expressys; Vector Backbone:pZE32; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-08-15 01:17:42 2
ML40K1
 
Resource Report
Resource Website 		RRID:Addgene_61920 none Chloramphenicol PMID:21925267 Genotype = cyo ilvE avtA aspC hisG argH metA lysA Precursor strain = ML31 Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His, Arg, Met, Lys ML40(K1) contains an extra pACYC plasmid carrying the cat cassette plus extra tRNA genes (argU, ileY, leuW) from Agilent Technologies Inc. *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Vector Backbone:none; Vector Types:; Bacterial Resistance:Chloramphenicol 2026-08-15 01:17:47 0
pMU102
 
Resource Report
Resource Website 		RRID:Addgene_61805 Chloramphenicol PMID:22578246 Backbone Marker:Bacillus Genetic Stock Center; Backbone Size:4217; Vector Backbone:pNW33N; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-08-15 01:17:46 0
pACYC-GST
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_62329 Chloramphenicol Backbone Marker:Structural Genomics Consortium; Backbone Size:8362; Vector Backbone:pACYC-LIC+; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:17:52 1
pCas9-CR4
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_62655 Cas9 nuclease Chloramphenicol PMID:26463009 Please note that this plasmid runs as a dimer (>13kb). While this may reduce DNA yield, the plasmid still functions as expected. Vector Backbone:pdCas9-bacteria; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:17:54 23
pJPC12-ΔM13-mCherry-PR/PRM-GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_80859 mCherry Synthetic Chloramphenicol PMID:27982027 The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201) Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:20:42 2
pJPC12-ΔM13-mCherry-P/PM,4A5C6G7G-GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_80914 mCherry Synthetic Chloramphenicol PMID:27982027 The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201) Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:20:43 1
pJPC12-ΔM13-mCherry-P/PM,4A5T6T-GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_80913 mCherry Synthetic Chloramphenicol PMID:27982027 The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201) Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:20:42 1
pJPC12-ΔM13-mCherry-P/PM,5G6T-GFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_80912 mCherry Synthetic Chloramphenicol PMID:27982027 The pJPC12 vector was obtained from Peterson and Phillips (Peterson, J. and G.J. Phillips, New pSC101-derivative cloning vectors with elevated copy numbers. Plasmid, 2008. 59(3): p. 193-201) Vector Backbone:pJPC12; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:20:42 1
pACYC-mTET1-N
 
Resource Report
Resource Website 		RRID:Addgene_81056 TET1 Mus musculus Chloramphenicol PMID:26932196 Backbone Marker:Novagen; Backbone Size:4008; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol N-terminus, amino acids 301-1366 2026-08-15 01:20:43 0
pSB1
 
Resource Report
Resource Website 		RRID:Addgene_81227 Encodes the hybrid receptor of E. coli chemoreceptor Tar and B. subtilis chemoreceptor McpC: Tar[1-43]-McpC[49-270]-Tar[184-553] E. coli, B. subtilis Chloramphenicol PMID:27285081 Backbone Size:4211; Vector Backbone:pKG116; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:20:45 0
D. vulgaris sp2 CRISPR/pACYCDuet-1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_81186 Synthetic CRISPR array (3 copies of D. vulgaris spacer #2 flanked by repeats) Desulfovibrio vulgaris str. Hildenborough Chloramphenicol PMID:27588603 Spacer sequence: GCCATGCTCAGGCTGGCGAGTGCGCCACTCATCAA Repeat sequence: GTCGCCCCCCACGCGGGGGCGTGGATTGAAAC Backbone Marker:Novagen; Backbone Size:4008; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol 2026-08-15 01:20:44 1
pSALECTNK-TEM1(S70A,D179G)/csTEM1
 
Resource Report
Resource Website 		RRID:Addgene_81163 TEM-1 beta-lactamase Synthetic Chloramphenicol PMID:28196882 Backbone Size:3224; Vector Backbone:pSALECT; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol Deleted the sec transport tag. Plasmid encodes H26 to W290. Mutations S70A, D179G. 2026-08-15 01:20:45 0
pSB8
 
Resource Report
Resource Website 		RRID:Addgene_82037 Encodes the hybrid receptor of E. coli chemoreceptor Tar and histidine kinase CitA: CitA[1-193]-Tar[204-553] E. coli Chloramphenicol PMID:27285081 Backbone Size:4211; Vector Backbone:pKG116; Vector Types:; Bacterial Resistance:Chloramphenicol 2026-08-15 01:20:52 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch