Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 71 showing 1401 ~ 1420 out of 164,537 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_105134

http://www.addgene.org/105134

Species: C. difficile
Genetic Insert: Upstream & Downstream pyrE deletion region
Vector Backbone Description: Backbone Size:6324; Vector Backbone:pJS116; Vector Types:E. coli - C. difficile shuttle vector; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29116155

Proper citation: RRID:Addgene_105134 Copy   


  • RRID:Addgene_105133

    This resource has 1+ mentions.

http://www.addgene.org/105133

Species: C. difficile
Genetic Insert: Upstream & Downstream pyrE deletion region
Vector Backbone Description: Backbone Size:6297; Vector Backbone:pMTL84151; Vector Types:E. coli - C. difficile shuttle vector; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29116155

Proper citation: RRID:Addgene_105133 Copy   


  • RRID:Addgene_112792

http://www.addgene.org/112792

Species: Synthetic
Genetic Insert: Pveg-eGFP
Vector Backbone Description: Backbone Marker:iGEM; Backbone Size:3185; Vector Backbone:pSB1C3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: Please visit https://www.biorxiv.org/content/early/2017/09/06/185108 for bioRxiv preprint.

Proper citation: RRID:Addgene_112792 Copy   


  • RRID:Addgene_112775

http://www.addgene.org/112775

Species: Synthetic
Genetic Insert: P43 promoter
Vector Backbone Description: Backbone Marker:iGEM; Backbone Size:2115; Vector Backbone:pSB1C3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: Please visit https://www.biorxiv.org/content/early/2017/09/06/185108 for bioRxiv preprint.

Proper citation: RRID:Addgene_112775 Copy   


  • RRID:Addgene_112778

http://www.addgene.org/112778

Species: Synthetic
Genetic Insert: Pspac promoter
Vector Backbone Description: Backbone Marker:iGEM; Backbone Size:2115; Vector Backbone:pSB1C3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: Please visit https://www.biorxiv.org/content/early/2017/09/06/185108 for bioRxiv preprint.

Proper citation: RRID:Addgene_112778 Copy   


  • RRID:Addgene_112777

http://www.addgene.org/112777

Species: Synthetic
Genetic Insert: PliaG promoter
Vector Backbone Description: Backbone Marker:iGEM; Backbone Size:2115; Vector Backbone:pSB1C3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: Please visit https://www.biorxiv.org/content/early/2017/09/06/185108 for bioRxiv preprint.

Proper citation: RRID:Addgene_112777 Copy   


  • RRID:Addgene_113244

http://www.addgene.org/113244

Species: E. coli
Genetic Insert: IHFa F13A
Vector Backbone Description: Backbone Size:3600; Vector Backbone:pACYC; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28729350

Proper citation: RRID:Addgene_113244 Copy   


  • RRID:Addgene_113320

http://www.addgene.org/113320

Species: Other
Genetic Insert: dCas9, MCP-TetD, J107 scRNA.b1_MS2
Vector Backbone Description: Vector Backbone:p15A vector; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29950558

Proper citation: RRID:Addgene_113320 Copy   


  • RRID:Addgene_113324

http://www.addgene.org/113324

Species: Other
Genetic Insert: dCas9 and MCP-SoxS_R93A
Vector Backbone Description: Vector Backbone:p15A vector; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29950558
Comments: Plasmid contains a G nucleotide deletion in the BBa_B1002 terminator sequence, which is not known to affect plasmid function.

Proper citation: RRID:Addgene_113324 Copy   


  • RRID:Addgene_113648

    This resource has 1+ mentions.

http://www.addgene.org/113648

Species: Other
Genetic Insert: ndmC
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/COGhnD32 . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.

Proper citation: RRID:Addgene_113648 Copy   


  • RRID:Addgene_113647

    This resource has 1+ mentions.

http://www.addgene.org/113647

Species: Other
Genetic Insert: ndmB
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/2C3Oh1ew . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.

Proper citation: RRID:Addgene_113647 Copy   


  • RRID:Addgene_113646

http://www.addgene.org/113646

Species: Other
Genetic Insert: ndmA
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/4vRm4arA . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.

Proper citation: RRID:Addgene_113646 Copy   


  • RRID:Addgene_113633

http://www.addgene.org/113633

Species: E. coli
Genetic Insert: Chloramphenicol resistance gene
Vector Backbone Description: Vector Backbone:pCas; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29884781

Proper citation: RRID:Addgene_113633 Copy   


  • RRID:Addgene_113651

    This resource has 1+ mentions.

http://www.addgene.org/113651

Species: Other
Genetic Insert: ndmB and ndmC
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/kNCaeGXO . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.

Proper citation: RRID:Addgene_113651 Copy   


  • RRID:Addgene_113652

    This resource has 1+ mentions.

http://www.addgene.org/113652

Species: Other
Genetic Insert: ndmA and ndmB and ndmC
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/xeoN8t6c . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.

Proper citation: RRID:Addgene_113652 Copy   


http://www.addgene.org/115654

Species: Moraxella bovoculi
Genetic Insert: MbCas12a
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:2600; Vector Backbone:CmR/p15A; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:30190307

Proper citation: RRID:Addgene_115654 Copy   


  • RRID:Addgene_11665

    This resource has 1+ mentions.

http://www.addgene.org/11665

Species: Firefly
Genetic Insert: FF3
Vector Backbone Description: Backbone Size:8595; Vector Backbone:pPRIME-CMV-Neo; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:16141338
Comments: CMV promoter transcribes Neo and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site. Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)

Proper citation: RRID:Addgene_11665 Copy   


  • RRID:Addgene_11662

    This resource has 1+ mentions.

http://www.addgene.org/11662

Species: Firefly
Genetic Insert: FF3
Vector Backbone Description: Backbone Size:8226; Vector Backbone:pPRIME-TET-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:16141338
Comments: TET promoter (minimal CMV promoter containing seven upstream Tet-operator sites) transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site. Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)

Proper citation: RRID:Addgene_11662 Copy   


  • RRID:Addgene_101068

http://www.addgene.org/101068

Species: Rhodopseudomonas palustris CGA009
Genetic Insert: ppsR2
Vector Backbone Description: Vector Backbone:pProTet.E333; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29091422

Proper citation: RRID:Addgene_101068 Copy   


  • RRID:Addgene_101694

    This resource has 1+ mentions.

http://www.addgene.org/101694

Genetic Insert: CCAT-[MTS from S. cerevisiae Pyruvate dehydrogenase E1 component subunit alpha (YER178W)]-AATG
Vector Backbone Description: Vector Backbone:pUPD2; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29132331

Proper citation: RRID:Addgene_101694 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X