Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: C. difficile
Genetic Insert: Upstream & Downstream pyrE deletion region
Vector Backbone Description: Backbone Size:6324; Vector Backbone:pJS116; Vector Types:E. coli - C. difficile shuttle vector; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29116155
Proper citation: RRID:Addgene_105134 Copy
Species: C. difficile
Genetic Insert: Upstream & Downstream pyrE deletion region
Vector Backbone Description: Backbone Size:6297; Vector Backbone:pMTL84151; Vector Types:E. coli - C. difficile shuttle vector; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29116155
Proper citation: RRID:Addgene_105133 Copy
Species: Synthetic
Genetic Insert: Pveg-eGFP
Vector Backbone Description: Backbone Marker:iGEM; Backbone Size:3185; Vector Backbone:pSB1C3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: Please visit https://www.biorxiv.org/content/early/2017/09/06/185108 for bioRxiv preprint.
Proper citation: RRID:Addgene_112792 Copy
Species: Synthetic
Genetic Insert: P43 promoter
Vector Backbone Description: Backbone Marker:iGEM; Backbone Size:2115; Vector Backbone:pSB1C3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: Please visit https://www.biorxiv.org/content/early/2017/09/06/185108 for bioRxiv preprint.
Proper citation: RRID:Addgene_112775 Copy
Species: Synthetic
Genetic Insert: Pspac promoter
Vector Backbone Description: Backbone Marker:iGEM; Backbone Size:2115; Vector Backbone:pSB1C3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: Please visit https://www.biorxiv.org/content/early/2017/09/06/185108 for bioRxiv preprint.
Proper citation: RRID:Addgene_112778 Copy
Species: Synthetic
Genetic Insert: PliaG promoter
Vector Backbone Description: Backbone Marker:iGEM; Backbone Size:2115; Vector Backbone:pSB1C3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: Please visit https://www.biorxiv.org/content/early/2017/09/06/185108 for bioRxiv preprint.
Proper citation: RRID:Addgene_112777 Copy
Species: E. coli
Genetic Insert: IHFa F13A
Vector Backbone Description: Backbone Size:3600; Vector Backbone:pACYC; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28729350
Proper citation: RRID:Addgene_113244 Copy
Species: Other
Genetic Insert: dCas9, MCP-TetD, J107 scRNA.b1_MS2
Vector Backbone Description: Vector Backbone:p15A vector; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29950558
Proper citation: RRID:Addgene_113320 Copy
Species: Other
Genetic Insert: dCas9 and MCP-SoxS_R93A
Vector Backbone Description: Vector Backbone:p15A vector; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29950558
Comments: Plasmid contains a G nucleotide deletion in the BBa_B1002 terminator sequence, which is not known to affect plasmid function.
Proper citation: RRID:Addgene_113324 Copy
Species: Other
Genetic Insert: ndmC
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/COGhnD32 . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.
Proper citation: RRID:Addgene_113648 Copy
Species: Other
Genetic Insert: ndmB
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/2C3Oh1ew . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.
Proper citation: RRID:Addgene_113647 Copy
Species: Other
Genetic Insert: ndmA
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/4vRm4arA . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.
Proper citation: RRID:Addgene_113646 Copy
Species: E. coli
Genetic Insert: Chloramphenicol resistance gene
Vector Backbone Description: Vector Backbone:pCas; Vector Types:CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29884781
Proper citation: RRID:Addgene_113633 Copy
Species: Other
Genetic Insert: ndmB and ndmC
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/kNCaeGXO . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.
Proper citation: RRID:Addgene_113651 Copy
Species: Other
Genetic Insert: ndmA and ndmB and ndmC
Vector Backbone Description: Vector Backbone:pSB1C3; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31540989
Comments: https://benchling.com/s/xeoN8t6c . Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.
Proper citation: RRID:Addgene_113652 Copy
Species: Moraxella bovoculi
Genetic Insert: MbCas12a
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:2600; Vector Backbone:CmR/p15A; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:30190307
Proper citation: RRID:Addgene_115654 Copy
Species: Firefly
Genetic Insert: FF3
Vector Backbone Description: Backbone Size:8595; Vector Backbone:pPRIME-CMV-Neo; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:16141338
Comments: CMV promoter transcribes Neo and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.
Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)
Proper citation: RRID:Addgene_11665 Copy
Species: Firefly
Genetic Insert: FF3
Vector Backbone Description: Backbone Size:8226; Vector Backbone:pPRIME-TET-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:16141338
Comments: TET promoter (minimal CMV promoter containing seven upstream Tet-operator sites) transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.
Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)
Proper citation: RRID:Addgene_11662 Copy
Species: Rhodopseudomonas palustris CGA009
Genetic Insert: ppsR2
Vector Backbone Description: Vector Backbone:pProTet.E333; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29091422
Proper citation: RRID:Addgene_101068 Copy
Genetic Insert: CCAT-[MTS from S. cerevisiae Pyruvate dehydrogenase E1 component subunit alpha (YER178W)]-AATG
Vector Backbone Description: Vector Backbone:pUPD2; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29132331
Proper citation: RRID:Addgene_101694 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
