Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 71 showing 1401 ~ 1420 out of 69,553 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_60185

http://www.addgene.org/60185

Species: Homo sapiens
Genetic Insert: Dysferlin
Vector Backbone Description: Backbone Size:2363; Vector Backbone:pUC57-Kan; Vector Types:cloning vector; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_60185 Copy   


  • RRID:Addgene_60190

http://www.addgene.org/60190

Species: Homo sapiens
Genetic Insert: Dysferlin
Vector Backbone Description: Backbone Size:2363; Vector Backbone:pUC57-Kan; Vector Types:cloning vector; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_60190 Copy   


  • RRID:Addgene_60195

http://www.addgene.org/60195

Species: Homo sapiens
Genetic Insert: Dysferlin
Vector Backbone Description: Backbone Size:2363; Vector Backbone:pUC57-Kan; Vector Types:cloning vector; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_60195 Copy   


  • RRID:Addgene_60193

http://www.addgene.org/60193

Species: Homo sapiens
Genetic Insert: Dysferlin
Vector Backbone Description: Backbone Size:2363; Vector Backbone:pUC57-Kan; Vector Types:cloning vector; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_60193 Copy   


  • RRID:Addgene_60197

http://www.addgene.org/60197

Species: Homo sapiens
Genetic Insert: Dysferlin
Vector Backbone Description: Backbone Size:2363; Vector Backbone:pUC57-Kan; Vector Types:cloning vector; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_60197 Copy   


  • RRID:Addgene_60196

http://www.addgene.org/60196

Species: Homo sapiens
Genetic Insert: Dysferlin
Vector Backbone Description: Backbone Size:2363; Vector Backbone:pUC57-Kan; Vector Types:cloning vector; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_60196 Copy   


  • RRID:Addgene_60258

http://www.addgene.org/60258

Species: Homo sapiens
Genetic Insert: NKX6-1 enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr4; start: 85558293 end: 85558959 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACC AGAGAACAACAGGCAGGT Rv primer used for cloning: TCATTGAACTTCCCCGATGG

Proper citation: RRID:Addgene_60258 Copy   


  • RRID:Addgene_60257

http://www.addgene.org/60257

Species: Homo sapiens
Genetic Insert: KIRREL3 enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr11; start: 126232858 end: 126233700 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGTGTGGGAGAAAAGTCTTCA Rv primer used for cloning: TGCCTTGTGAATGGCAGAGGAG

Proper citation: RRID:Addgene_60257 Copy   


  • RRID:Addgene_60256

http://www.addgene.org/60256

Species: Homo sapiens
Genetic Insert: SLC30A8 enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr8; start: 118326349 end: 118327201 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGGAGGTCAGAGTTGCCTACA Rv primer used for cloning: CATGGATTCAGGCCATTCCTGTCA

Proper citation: RRID:Addgene_60256 Copy   


  • RRID:Addgene_60254

http://www.addgene.org/60254

Species: Homo sapiens
Genetic Insert: WSCD2 enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr12; start: 107010900 end: 107011629 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCCATCACCTGTGACCTTTT Rv primer used for cloning: ACAGGGGCTGGGCAACATTC

Proper citation: RRID:Addgene_60254 Copy   


  • RRID:Addgene_60252

http://www.addgene.org/60252

Species: Homo sapiens
Genetic Insert: SPATA19 inactive enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr11; start: 133163067 end: 133163569 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCGAAGGAGTCTGTTGTCAC Rv primer used for cloning: GCCCCTAAAATCAAGGCAATTGAG

Proper citation: RRID:Addgene_60252 Copy   


  • RRID:Addgene_60251

http://www.addgene.org/60251

Species: Homo sapiens
Genetic Insert: SMYD3 inactive enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr1; start: 244375383 end: 244375884 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCATCTGAGCTTCACTGGATT Rv primer used for cloning: TGAGTTTTGAAGTCAGACAGACCTGGA

Proper citation: RRID:Addgene_60251 Copy   


  • RRID:Addgene_60269

http://www.addgene.org/60269

Species: Homo sapiens
Genetic Insert: OBFC2A enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr2; start: 192035133 end: 192035929 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCGCGCTGTATGCAAAGTGAGG Rv primer used for cloning: TGTCCCCAAAACTGCTCCCACA

Proper citation: RRID:Addgene_60269 Copy   


  • RRID:Addgene_60302

http://www.addgene.org/60302

Species: Homo sapiens
Genetic Insert: THADA enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr2; start: 43564683 end: 43565659 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCAATCATCCCTCCACAAGAGT Rv primer used for cloning: GCAAGGTAGCAAGGGGTGAAATG

Proper citation: RRID:Addgene_60302 Copy   


  • RRID:Addgene_60301

http://www.addgene.org/60301

Species: Homo sapiens
Genetic Insert: ZBED3 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr5; start: 76470322 end: 76471169 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCGCCTTTTCTACTTTGCCTA Rv primer used for cloning: TCCACTAGGAGTTTTGGAATGAGTGAA

Proper citation: RRID:Addgene_60301 Copy   


  • RRID:Addgene_60304

http://www.addgene.org/60304

Species: Homo sapiens
Genetic Insert: ZMIZ1 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr10; start: 80613972 end: 80614474 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCCTCTGTCTTCCTTCCACCA Rv primer used for cloning: CACGGCTCCATTGGCATCTCC

Proper citation: RRID:Addgene_60304 Copy   


  • RRID:Addgene_60309

http://www.addgene.org/60309

Species: Homo sapiens
Genetic Insert: ZFP36L2 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr2; start: 43451134 end: 43452137 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCTGCTTATTTGAAAACATTTGA Rv primer used for cloning: CCCTCTCAACAAAAACTGAGCA

Proper citation: RRID:Addgene_60309 Copy   


  • RRID:Addgene_60308

http://www.addgene.org/60308

Species: Homo sapiens
Genetic Insert: CRY2 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr11; start: 45836041 end: 45836866 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCTGTGCATGGCTAGGACATT Rv primer used for cloning: TCCCCATTCCTGTGGGGAGAG

Proper citation: RRID:Addgene_60308 Copy   


  • RRID:Addgene_60307

http://www.addgene.org/60307

Species: Homo sapiens
Genetic Insert: C16orf80 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr16; start: 56718269 end: 56718865 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCCGGCCCCAAACTTTCCTTT Rv primer used for cloning: GGGCCCTCTGTGCCAGTGGAAT

Proper citation: RRID:Addgene_60307 Copy   


  • RRID:Addgene_60265

http://www.addgene.org/60265

Species: Homo sapiens
Genetic Insert: THADA enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr2; start: 43564683 end: 43565659 (genomic position corresponds to the version of the human genome hg18) Fw primer used for cloning: CACCAATCATCCCTCCACAAGAGT Rv primer used for cloning: GCAAGGTAGCAAGGGGTGAAATG

Proper citation: RRID:Addgene_60265 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X