Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Dysferlin
Vector Backbone Description: Backbone Size:2363; Vector Backbone:pUC57-Kan; Vector Types:cloning vector; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_60185 Copy
Species: Homo sapiens
Genetic Insert: Dysferlin
Vector Backbone Description: Backbone Size:2363; Vector Backbone:pUC57-Kan; Vector Types:cloning vector; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_60190 Copy
Species: Homo sapiens
Genetic Insert: Dysferlin
Vector Backbone Description: Backbone Size:2363; Vector Backbone:pUC57-Kan; Vector Types:cloning vector; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_60195 Copy
Species: Homo sapiens
Genetic Insert: Dysferlin
Vector Backbone Description: Backbone Size:2363; Vector Backbone:pUC57-Kan; Vector Types:cloning vector; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_60193 Copy
Species: Homo sapiens
Genetic Insert: Dysferlin
Vector Backbone Description: Backbone Size:2363; Vector Backbone:pUC57-Kan; Vector Types:cloning vector; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_60197 Copy
Species: Homo sapiens
Genetic Insert: Dysferlin
Vector Backbone Description: Backbone Size:2363; Vector Backbone:pUC57-Kan; Vector Types:cloning vector; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_60196 Copy
Species: Homo sapiens
Genetic Insert: NKX6-1 enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr4; start: 85558293 end: 85558959 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACC AGAGAACAACAGGCAGGT Rv primer used for cloning: TCATTGAACTTCCCCGATGG
Proper citation: RRID:Addgene_60258 Copy
Species: Homo sapiens
Genetic Insert: KIRREL3 enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr11; start: 126232858 end: 126233700 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCGTGTGGGAGAAAAGTCTTCA Rv primer used for cloning: TGCCTTGTGAATGGCAGAGGAG
Proper citation: RRID:Addgene_60257 Copy
Species: Homo sapiens
Genetic Insert: SLC30A8 enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr8; start: 118326349 end: 118327201 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCGGAGGTCAGAGTTGCCTACA Rv primer used for cloning: CATGGATTCAGGCCATTCCTGTCA
Proper citation: RRID:Addgene_60256 Copy
Species: Homo sapiens
Genetic Insert: WSCD2 enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr12; start: 107010900 end: 107011629 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCCCATCACCTGTGACCTTTT Rv primer used for cloning: ACAGGGGCTGGGCAACATTC
Proper citation: RRID:Addgene_60254 Copy
Species: Homo sapiens
Genetic Insert: SPATA19 inactive enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr11; start: 133163067 end: 133163569 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCCGAAGGAGTCTGTTGTCAC Rv primer used for cloning: GCCCCTAAAATCAAGGCAATTGAG
Proper citation: RRID:Addgene_60252 Copy
Species: Homo sapiens
Genetic Insert: SMYD3 inactive enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr1; start: 244375383 end: 244375884 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCCATCTGAGCTTCACTGGATT Rv primer used for cloning: TGAGTTTTGAAGTCAGACAGACCTGGA
Proper citation: RRID:Addgene_60251 Copy
Species: Homo sapiens
Genetic Insert: OBFC2A enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr2; start: 192035133 end: 192035929 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCGCGCTGTATGCAAAGTGAGG Rv primer used for cloning: TGTCCCCAAAACTGCTCCCACA
Proper citation: RRID:Addgene_60269 Copy
Species: Homo sapiens
Genetic Insert: THADA enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr2; start: 43564683 end: 43565659 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCAATCATCCCTCCACAAGAGT Rv primer used for cloning: GCAAGGTAGCAAGGGGTGAAATG
Proper citation: RRID:Addgene_60302 Copy
Species: Homo sapiens
Genetic Insert: ZBED3 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr5; start: 76470322 end: 76471169 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCCGCCTTTTCTACTTTGCCTA Rv primer used for cloning: TCCACTAGGAGTTTTGGAATGAGTGAA
Proper citation: RRID:Addgene_60301 Copy
Species: Homo sapiens
Genetic Insert: ZMIZ1 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr10; start: 80613972 end: 80614474 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCCCTCTGTCTTCCTTCCACCA Rv primer used for cloning: CACGGCTCCATTGGCATCTCC
Proper citation: RRID:Addgene_60304 Copy
Species: Homo sapiens
Genetic Insert: ZFP36L2 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr2; start: 43451134 end: 43452137 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCTGCTTATTTGAAAACATTTGA Rv primer used for cloning: CCCTCTCAACAAAAACTGAGCA
Proper citation: RRID:Addgene_60309 Copy
Species: Homo sapiens
Genetic Insert: CRY2 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr11; start: 45836041 end: 45836866 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCCTGTGCATGGCTAGGACATT Rv primer used for cloning: TCCCCATTCCTGTGGGGAGAG
Proper citation: RRID:Addgene_60308 Copy
Species: Homo sapiens
Genetic Insert: C16orf80 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr16; start: 56718269 end: 56718865 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCCGGCCCCAAACTTTCCTTT Rv primer used for cloning: GGGCCCTCTGTGCCAGTGGAAT
Proper citation: RRID:Addgene_60307 Copy
Species: Homo sapiens
Genetic Insert: THADA enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr2; start: 43564683 end: 43565659 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCAATCATCCCTCCACAAGAGT Rv primer used for cloning: GCAAGGTAGCAAGGGGTGAAATG
Proper citation: RRID:Addgene_60265 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.