Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 72 showing 1421 ~ 1440 out of 328,630 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/45630

Species: Mus musculus
Genetic Insert: Lpl in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Lpl fragment was amplified by RT-PCR using the following primer pair: TGCTGTGCAAAGAGAAGAGC CGGACACAAAGTTAGCACCA For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 3249-3900 of NM_008509.2, not bp# 3169-3826 as indicated on plasmid map. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_45630 Copy   


http://www.addgene.org/45633

Species: Mus musculus
Genetic Insert: Nectin-3 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Nectin-3 fragment was amplified by RT-PCR using the following primer pair: AAACAACCTGATCCGCAAAG CAGTGAAAACTGTAAAGCAGCTC For in vitro transcription, use the BamHI restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1626-2039 of NM_021495, not bp# 1624-2036 as indicated on plasmid map. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_45633 Copy   


http://www.addgene.org/45632

Species: Mus musculus
Genetic Insert: Ptn in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Ptn fragment was amplified by RT-PCR using the following primer pair: GCCTACCCGTCCAAATATCC GCCAGTTCTGGTCTTCAAGG For in vitro transcription, use the NotI restriction digest and SP6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1241-1830 of NM_008973, not bp# 1238-1827 as indicated on plasmid map. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_45632 Copy   


http://www.addgene.org/45634

Species: Rattus norvegicus
Genetic Insert: AT1AR-TSTS/A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA3.1/Zeo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15355986
Comments: Mutant AT1A receptors were generated by mutagenesis PCR using pcDNA3.1-HA-AT1A receptor (provided by M. G. Caron, Duke University) as a template and a QuikChange multisite-directed mutagenesis kit (Stratagene) according to the manufacturer’s instructions. The primer for the TSTS/A receptor was: 5' p-CTCAAGCCTGTCTGCGAAAATGGCCGCTTGCTTACCGGCCTTC 3'. N4D mutation introduced to prevent glycosylation at this consensus site and steric hindrance of antibody binding.

Proper citation: RRID:Addgene_45634 Copy   


http://www.addgene.org/45628

Species: Mus musculus
Genetic Insert: Gpr88 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Gpr88 fragment was amplified by RT-PCR using the following primer pair: CAAATGAAACCAATGGTCAGG TATCTGTTTCCCGTGTCTCC For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 2742-3255 of AB042408.1 or bp# 2772-3285 of NM_022427, not bp# 2742-3255 of NM_022427 as indicated on plasmid map. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_45628 Copy   


http://www.addgene.org/45620

Species: Mus musculus
Genetic Insert: Foxp2 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16157277
Comments: The Fox2p fragment was amplified by RT-PCR using the following primer pair: CAGTGTGGACTGTGGACGAA TTCCAGGTCCTCAGATAAAGG For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp#1709-2142 of AF339106, not bp# 1707-2142 as indicated on plasmid map. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_45620 Copy   


http://www.addgene.org/45622

Species: Mus musculus
Genetic Insert: Tcrb-V13 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16157277
Comments: The Tcrb-V13 fragment was amplified by RT-PCR using the following primer pair: CTGAGCTGGTGGGTGAATG AAGGTGTCAACGAGGAAGGA For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 533-1058 of X67128, not bp# 532-1059 as indicated on plasmid map. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_45622 Copy   


http://www.addgene.org/45621

Species: Mus musculus
Genetic Insert: Plexin D1 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16157277
Comments: The Plexin D1 fragment was amplified by RT-PCR using the following primer pair: CAGGAAATGAACGCACACC TGAGGGACACAGACAACTGC; For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation.

Proper citation: RRID:Addgene_45621 Copy   


http://www.addgene.org/45623

Species: Mus musculus
Genetic Insert: Cux2 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16157277
Comments: The Cux2 fragment was amplified by RT-PCR using the following primer pair: TCAGTCAACAGCTCCATTCG GACAGCGAGAAAGTCCTTGG For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation.

Proper citation: RRID:Addgene_45623 Copy   


  • RRID:Addgene_45615

http://www.addgene.org/45615

Species: Nostoc punctiforme
Genetic Insert: GFPN-NpuDnaE_intein-GFP_C
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:4597; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23974115

Proper citation: RRID:Addgene_45615 Copy   


  • RRID:Addgene_45616

http://www.addgene.org/45616

Species: (Methanocaldococcus jannaschii DSM 2661)
Genetic Insert: MjaTFIIBC53
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4597; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23974115
Comments: There are 2 mismatches between Addgene's quality control and depositor's reference sequence. These changes are in backbone region and should not affect function.

Proper citation: RRID:Addgene_45616 Copy   


http://www.addgene.org/45574

Genetic Insert: co I-Sce I
Vector Backbone Description: Backbone Size:5071; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24121685

Proper citation: RRID:Addgene_45574 Copy   


http://www.addgene.org/45575

Species: Homo sapiens
Genetic Insert: eGFP with I-Sce I TS
Vector Backbone Description: Backbone Size:4483; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Bacterial Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24121685

Proper citation: RRID:Addgene_45575 Copy   


http://www.addgene.org/45578

Genetic Insert: coY2 Ani
Vector Backbone Description: Backbone Size:5071; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24121685

Proper citation: RRID:Addgene_45578 Copy   


  • RRID:Addgene_45699

    This resource has 1+ mentions.

http://www.addgene.org/45699

Species: Homo sapiens
Genetic Insert: FGFR2 IIIc
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23786770

Proper citation: RRID:Addgene_45699 Copy   


  • RRID:Addgene_45610

http://www.addgene.org/45610

Species: Pyrococcus horikoshii
Genetic Insert: PhoRadAC46
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:4597; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23974115
Comments: There are 2 mismatches between Addgene's quality control and depositor's reference sequence. These changes are in backbone region and should not affect function.

Proper citation: RRID:Addgene_45610 Copy   


  • RRID:Addgene_45698

    This resource has 1+ mentions.

http://www.addgene.org/45698

Species: Homo sapiens
Genetic Insert: FGFR2 IIIb
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23786770

Proper citation: RRID:Addgene_45698 Copy   


http://www.addgene.org/45579

Genetic Insert: coY2 Ani K227M
Vector Backbone Description: Backbone Size:5071; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24121685

Proper citation: RRID:Addgene_45579 Copy   


  • RRID:Addgene_45612

http://www.addgene.org/45612

Species: nostoc punctiforme
Genetic Insert: NpuDnaBC39
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4597; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23974115
Comments: There are 2 mismatches between Addgene's quality control and depositor's reference sequence. These changes are in backbone region and should not affect function.

Proper citation: RRID:Addgene_45612 Copy   


  • RRID:Addgene_45570

    This resource has 1+ mentions.

http://www.addgene.org/45570

Species: Homo sapiens
Genetic Insert: TRIM28
Vector Backbone Description: Backbone Marker:Amersham GE Healthcare; Backbone Size:5000; Vector Backbone:pGEX-5X; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21940674
Comments: Full-length human TRIM28 was purchased from Origene and subcloned into vector pKH3 to generate pKH3-Trim28 (Addgene plasmid #45569). A full length TRIM28 DNA fragment was then generated from pKH3-TRIM28 by PCR and cloned into pGEX-5X.

Proper citation: RRID:Addgene_45570 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X