Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: E. coli
Genetic Insert: MlaC
Vector Backbone Description: Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37100290
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.12.09.519820v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_195683 Copy
Species: E. coli
Genetic Insert: β-galactosidase α gene fragment
Vector Backbone Description: Backbone Size:35555; Vector Backbone:pAd5-Blue; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28039799
Proper citation: RRID:Addgene_174431 Copy
Species: E. coli
Genetic Insert: T7 polymerase
Vector Backbone Description: Backbone Size:5739; Vector Backbone:pSRKGm; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:36645284
Comments: The T7 polymerase gene (1) was cloned from the chromosome of BL21(DE3).
Proper citation: RRID:Addgene_192981 Copy
Species: E. coli
Genetic Insert: folA, thyA
Vector Backbone Description: Vector Backbone:pTET-duet; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38637543
Comments: Please visit https://doi.org/10.1101/2023.05.28.542639 for bioRxiv preprint.
Proper citation: RRID:Addgene_191304 Copy
Species: E. coli
Genetic Insert: BirA_Ecoli
Vector Backbone Description: Backbone Marker:SGC (Addgene Plasmid #26099); Vector Backbone:pFBOH-LIC edited; Vector Types:Baculovirus expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37390814
Comments: SGC ID: BirA_Ecoli:TOC025-E08:C244778
Please visit https://www.biorxiv.org/content/10.1101/2022.11.21.516512v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_196581 Copy
Species: E. coli
Genetic Insert: tRNAfMet-A37U expression cassette
Vector Backbone Description: Vector Backbone:pSEVA361; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:36727459
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.05.02.490318v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_196659 Copy
Species: E. coli
Genetic Insert: tTA2
Vector Backbone Description: Vector Backbone:AAV with CAG promter; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38918382
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.10.20.512984v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_193338 Copy
Species: E. coli
Genetic Insert: TetR
Vector Backbone Description: Vector Backbone:pQE80; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36246369
Proper citation: RRID:Addgene_195199 Copy
Species: E. coli
Genetic Insert: CysGA-Im7 F84A
Vector Backbone Description: Backbone Size:3904; Vector Backbone:pTrc-99a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33753520
Proper citation: RRID:Addgene_201082 Copy
Species: E. coli
Genetic Insert: CysGA-Im7
Vector Backbone Description: Backbone Size:3904; Vector Backbone:pTrc-99a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33753520
Proper citation: RRID:Addgene_201081 Copy
Species: E. coli
Genetic Insert: E. coli tRNA Guanine Transglycosylase
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:5874; Vector Backbone:(T7)-2 Vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36988146
Proper citation: RRID:Addgene_206495 Copy
Species: E. coli
Genetic Insert: Cas7, Cas5, Cas8, Cas11, Cas6, and Cas3
Vector Backbone Description: Backbone Size:8900; Vector Backbone:pPV; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31811138
Proper citation: RRID:Addgene_204619 Copy
Species: E. coli
Genetic Insert: H6-SNAP-RapA
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pQE80L; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37406096
Proper citation: RRID:Addgene_199118 Copy
Species: E. coli
Genetic Insert: ΔtnaA ΔtrpR
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:35594503
Comments: Primers for PCR verification:
veri-trpR-F: AGCAGCTTATAACGCCGGACCAGGG
veri-trpR-R: TGGTCCCGTGATGTCGCGTTATAC
veri-tnaA-F: CTTGTTTTAGTAAATGATGGTGCTTG
veri-tnaA-R: GATCAGTCATGATGCCACCTTTAGAG
Proper citation: RRID:Addgene_205015 Copy
Species: E. coli
Genetic Insert: spike-A192
Vector Backbone Description: Backbone Size:5476; Vector Backbone:pET-25b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37001147
Proper citation: RRID:Addgene_200887 Copy
Species: E. coli
Genetic Insert: BirA::GFP
Vector Backbone Description: Backbone Size:2884; Vector Backbone:pWormgate2; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22219512
Proper citation: RRID:Addgene_45100 Copy
Species: e. coli
Genetic Insert: deGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4102; Vector Backbone:pBAD/His A; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20576148
Proper citation: RRID:Addgene_45397 Copy
Species: e. coli
Genetic Insert: deGFP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4486; Vector Backbone:pBEST-Luc; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20576148
Proper citation: RRID:Addgene_45392 Copy
Species: e. coli
Genetic Insert: tet repressor
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4486; Vector Backbone:pBEST-Luc; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20576148
Proper citation: RRID:Addgene_45391 Copy
Species: e. coli
Genetic Insert: deGFP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4486; Vector Backbone:pBEST-Luc; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20576148
Proper citation: RRID:Addgene_45394 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
