Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: jGCaMP8f L27A
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pET30b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37275778
Proper citation: RRID:Addgene_204138 Copy
Species: Rattus norvegicus
Genetic Insert: jGCaMP8f F366H
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pET30b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37275778
Proper citation: RRID:Addgene_204139 Copy
Species: Rattus norvegicus
Genetic Insert: jGCaMP8f L27A
Vector Backbone Description: Backbone Marker:ThermoFisher Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37275778
Comments: pGP-CMV-jGCaMP8f was a gift from GENIE Project (Addgene plasmid # 162373 ; http://n2t.net/addgene:162373 ; RRID:Addgene_162373)
We introduced the L27A mutation by site-directed mutagenesis
Proper citation: RRID:Addgene_204140 Copy
Species: Rattus norvegicus
Genetic Insert: jGCaMP8f F366H
Vector Backbone Description: Backbone Marker:ThermoFisher Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37275778
Comments: pGP-CMV-jGCaMP8f was a gift from GENIE Project (Addgene plasmid # 162373 ; http://n2t.net/addgene:162373 ; RRID:Addgene_162373)
We introduced the F366H mutation by site-directed mutagenesis
Proper citation: RRID:Addgene_204141 Copy
Species: Rattus norvegicus
Genetic Insert: 2',3'-cyclic nucleotide phosphodiesterase catalytic domain
Vector Backbone Description: Backbone Size:3641; Vector Backbone:pKT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29555843
Proper citation: RRID:Addgene_211803 Copy
Species: Rattus norvegicus
Genetic Insert: TRPV1-P2A-mCherry
Vector Backbone Description: Backbone Size:4400; Vector Backbone:AAV-CamKII-TRPV1-P2A-DsRed; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33989819
Proper citation: RRID:Addgene_200829 Copy
Species: Rattus norvegicus
Genetic Insert: Gephyrin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFPC2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23408424
Proper citation: RRID:Addgene_199609 Copy
Species: Rattus norvegicus
Genetic Insert: ND1-W86-R17 TALEN
Vector Backbone Description: Vector Backbone:pGL3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37058569
Comments: These plasmids may not be suitable for sequencing with NGS, because they contain RVD array. In our lab, we perform Sanger sequencing using the following primers: RVD seq Fwd TGACCGCAGTGGAGGCAGTG; RVD seq Rev TTCACTGCATCCAGCGCAGG
Proper citation: RRID:Addgene_198851 Copy
Species: Rattus norvegicus
Genetic Insert: APOBEC-nCas9-rXRCC1
Vector Backbone Description: Backbone Marker:origene; Backbone Size:3399; Vector Backbone:CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33654077
Proper citation: RRID:Addgene_165444 Copy
Species: Rattus norvegicus
Genetic Insert: APOBEC-nCas9-rPB(8kD)
Vector Backbone Description: Backbone Marker:origene; Backbone Size:3399; Vector Backbone:CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33654077
Proper citation: RRID:Addgene_165445 Copy
Species: Rattus norvegicus
Genetic Insert: mEGFP(A206K)-paCaMKII(T286A)
Vector Backbone Description: Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33531495
Comments: Only tested in HeLa cells, but not in neurons.
Proper citation: RRID:Addgene_165439 Copy
Species: Rattus norvegicus
Genetic Insert: FHS-paCaMKII
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33531495
Proper citation: RRID:Addgene_165429 Copy
Species: Rattus norvegicus
Genetic Insert: iGluSnFR extracellular domain fused to Stargazin (gamma-2) via NETO2 TM domain
Vector Backbone Description: Backbone Size:4753; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36622100
Comments: Chimera of iGluSnFR (Addgene plasmid # 41732), Neto2 and Gamma-2
pAAV backbone is based on Addgene #61463
Please visit https://doi.org/10.1101/2021.01.21.427382 for bioRxiv preprint.
Proper citation: RRID:Addgene_165497 Copy
Species: Rattus norvegicus
Genetic Insert: iGluSnFR extracellular domain fused to Stargazin (gamma-2) via NETO2 TM domain
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5460; Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36622100
Comments: Chimera of iGluSnFR (Addgene plasmid # 41732), Neto2 and Gamma-2 (Stargazin).
Please visit https://doi.org/10.1101/2021.01.21.427382 for bioRxiv preprint.
Proper citation: RRID:Addgene_165495 Copy
Species: Rattus norvegicus
Genetic Insert: iGluSnFR extracellular domain fused to gamma-8 via NETO2 TM domain
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5460; Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36622100
Comments: Chimera of iGluSnFR (Addgene plasmid # 41732), Neto2 and Gamma-8.
Please visit https://doi.org/10.1101/2021.01.21.427382 for bioRxiv preprint.
Proper citation: RRID:Addgene_165496 Copy
Species: Rattus norvegicus
Genetic Insert: CAMKII
Vector Backbone Description: Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Xenopus Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10777564
Comments: Description: Wild type CAMKII provided by H. Schulman (Vanderbilt) subcloned into the EcoRI site of CS2+. Linearize with Not 1 and transcribe with SP6.
Ref: M. Kuehl et al., JBC 275:12701-12711, 2000.
Proper citation: RRID:Addgene_16737 Copy
Species: Rattus norvegicus
Genetic Insert: CAMKII-K42M 1-271
Vector Backbone Description: Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Xenopus Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10777564
Comments: Description: A C-terminal truncation of K42M kinase dead CAMKII provided by H. Schulman (Vanderbilt), subcloned into the EcoRI site of CS2+. Linearize with Not 1 and transcribe with SP6.
Ref: M. Kuehl et al., JBC 275:12701-12711, 2000.
Proper citation: RRID:Addgene_16734 Copy
Species: Rattus norvegicus
Genetic Insert: mEGFP(A206K)-paCaMKII(I539E)-ShadowG
Vector Backbone Description: Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33531495
Comments: Only tested in HeLa cells, but not in neurons.
Proper citation: RRID:Addgene_167478 Copy
Species: Rattus norvegicus
Genetic Insert: mEGFP(A206K)-paCaMKII(C450A)-ShadowG
Vector Backbone Description: Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33531495
Comments: Only tested in HeLa cells, but not in neurons.
Proper citation: RRID:Addgene_167479 Copy
Species: Rattus norvegicus
Genetic Insert: Abnormal spindle-like microcephaly associated
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17534152
Comments: Please note that though this plasmid is in the pCMV-myc backbone, the myc tag is NOT in frame with the insert.
Proper citation: RRID:Addgene_27669 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
