Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: 3xFLAG-dCas9
Vector Backbone Description: Backbone Marker:Sigma-Aldrich; Backbone Size:4636; Vector Backbone:pCMV-7.1; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23942116
Comments: This plasmid can be used to isolate specific genomic regions of interest using a catalytically inactive Cas9 fused with a tag(s).
Purify: locus-specific chromatin immunoprecipitation (enChIP)
This system is compatible with gRNA_cloning_vector (www.addgene.org/41824) from the Church lab.
Additional information and protocols can be found at:
http://www.med.hirosaki-u.ac.jp/~bgb/iChIP_protocols/index_e.html
Proper citation: RRID:Addgene_47948 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979586
Comments: To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail.
Proper citation: RRID:Addgene_47946 Copy
Species: Rattus norvegicus
Genetic Insert: SAPAP1
Vector Backbone Description: Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9115257
Proper citation: RRID:Addgene_47940 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979586
Comments: To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail.
Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_47944 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979586
Comments: To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail.
Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_47945 Copy
Species: Synthetic
Genetic Insert: guide RNA
Vector Backbone Description: Backbone Marker:Geneart; Vector Backbone:pMK; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23979586
Proper citation: RRID:Addgene_47943 Copy
Species: Homo sapiens
Genetic Insert: MOB1A
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19919647
Proper citation: RRID:Addgene_47937 Copy
Species: Homo sapiens
Genetic Insert: CIN85
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16751601
Comments: The CIN85 insert in this plasmid contains a D114G mutation when compared to GenBank accession number NP_114098.1. This mutation was not intentional and was present in the original CIN85 clone.
Proper citation: RRID:Addgene_47935 Copy
Species: Homo sapiens
Genetic Insert: MOB1A
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19919647
Proper citation: RRID:Addgene_47936 Copy
Species: Homo sapiens
Genetic Insert: Miro2 A13V
Vector Backbone Description: Backbone Marker:Dr. Alan Hall, MRC-LMCB; Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16630562
Proper citation: RRID:Addgene_47896 Copy
Species: Homo sapiens
Genetic Insert: Miro2 T18N
Vector Backbone Description: Backbone Marker:Dr. Alan Hall, MRC-LMCB; Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16630562
Proper citation: RRID:Addgene_47897 Copy
Species: Danio rerio
Genetic Insert: golden gRNA
Vector Backbone Description: Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23918387
Comments: For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/
gRNA target sequence GGTCTCTCGCAGGATGTTGC
Proper citation: RRID:Addgene_47930 Copy
Species: Homo sapiens
Genetic Insert: Miro1 E208K/E328K
Vector Backbone Description: Backbone Marker:Dr. Alan Hall, MRC-LMCB; Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16630562
Proper citation: RRID:Addgene_47894 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:2730; Vector Backbone:pUC57; Vector Types:CRISPR, Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979578
Proper citation: RRID:Addgene_47933 Copy
Species: Homo sapiens
Genetic Insert: Dendrin-1
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pCI-neo (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16751601
Proper citation: RRID:Addgene_47934 Copy
Species: Danio rerio
Genetic Insert: mitfa gRNA
Vector Backbone Description: Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23918387
Comments: For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/
gRNA target sequence GGTCTCTCGCAGGATGTTGC
Proper citation: RRID:Addgene_47931 Copy
Species: Danio rerio
Genetic Insert: ddx19 gRNA
Vector Backbone Description: Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23918387
Comments: For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/
gRNA target sequence GGCAACAGATTCGTGGGCCC
Proper citation: RRID:Addgene_47932 Copy
Species: Homo sapiens
Genetic Insert: Miro2
Vector Backbone Description: Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12482879
Proper citation: RRID:Addgene_47891 Copy
Species: Mus musculus
Genetic Insert: E-Cadherin EC12
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5406; Vector Backbone:pET-22b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23923816
Comments: Plasmid contains E-Cadherin domains 1 and 2 (aa157-375, when compared to GenBank reference sequence NP_033994.1). Numbering of the mutations is relative to this sequence. The pro-peptide sequence that is normally cleaved during maturation was intentionally removed as part of the cloning strategy for expression in bacteria.
Proper citation: RRID:Addgene_47926 Copy
Species: Mus musculus
Genetic Insert: E-Cadherin EC12
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5406; Vector Backbone:pET-22b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23923816
Comments: Plasmid contains E-Cadherin domains 1 and 2 (aa157-375, when compared to GenBank reference sequence NP_033994.1). Numbering of the mutation is relative to this sequence. The pro-peptide sequence that is normally cleaved during maturation was intentionally removed as part of the cloning strategy for expression in bacteria.
Proper citation: RRID:Addgene_47924 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.