Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: ZBED3 enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr5; start: 76470322 end: 76471169 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCCGCCTTTTCTACTTTGCCTA Rv primer used for cloning: TCCACTAGGAGTTTTGGAATGAGTGAA
Proper citation: RRID:Addgene_60264 Copy
Species: Homo sapiens
Genetic Insert: GLIS3 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr9; start: 4279544 end: 4281151 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCGACAGGATTCCATCGGAAGA Rv primer used for cloning: CCAACGTTAGGCCTTGGGAGTGC
Proper citation: RRID:Addgene_60312 Copy
Species: Homo sapiens
Genetic Insert: SLC2A2 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr3; start: 172177343 end: 172179831 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCGTGTTTGAGCTCCCCTGAAA Rv primer used for cloning: TGGTGGTGGTTTGCTGAACCATGT
Proper citation: RRID:Addgene_60310 Copy
Species: Homo sapiens
Genetic Insert: ACSL1 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr4; start: 185953054 end: 185954041 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCCTCCCCACTATCCCAGAGGA Rv primer used for cloning: CTGGCAGGGTGCAAACATCAGC
Proper citation: RRID:Addgene_60316 Copy
Species: Homo sapiens
Genetic Insert: Non active element (nearest TSS C18orf26)
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr18; start: 50489292 end: 50489931 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCAGCCCTTGGTCAAGAATAGT Rv primer used for cloning: TGTAAGCGGTTTGGGCAATCTT
Proper citation: RRID:Addgene_60319 Copy
Species: Homo sapiens
Genetic Insert: Non active element (nearest TSS CCRN4L)
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr4; start: 139931533 end: 139932029 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCATGGTCGGATATGACAGTTT Rv primer used for cloning: CCCATGGGAATAAGGCCTGTAGA
Proper citation: RRID:Addgene_60321 Copy
Species: Homo sapiens
Genetic Insert: PCSK1 enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24413736
Comments: chromosome : chr5; start: 95655454 end: 95657341 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCGATCCACCAGCCTCAGTCTC Rv primer used for cloning: TGTGTGCATACATGATGCCCTTTG
Proper citation: RRID:Addgene_60280 Copy
Species: Homo sapiens
Genetic Insert: LINGO2 inactive enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr9; start: 29215891 end: 29216522 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCAGTGGGTTGTTTGTGTTTTT Rv primer used for cloning: TTGCTATGGTTAAGGTAAATGGCACA
Proper citation: RRID:Addgene_60287 Copy
Species: Homo sapiens
Genetic Insert: Dysferlin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2571; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_60217 Copy
Species: Homo sapiens
Genetic Insert: EDARADD inactive enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr1; start: 234595797 end: 234596272 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCTTCTGCAATGTTTAATCTGC Rv primer used for cloning: GGTCTCAGCTCAGTGGTAGGG
Proper citation: RRID:Addgene_60290 Copy
Species: Homo sapiens
Genetic Insert: KIRREL3 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr11; start: 126232858 end: 126233700 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCGTGTGGGAGAAAAGTCTTCA Rv primer used for cloning: TGCCTTGTGAATGGCAGAGGAG
Proper citation: RRID:Addgene_60294 Copy
Species: Homo sapiens
Genetic Insert: SLC30A8 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr8; start: 118326349 end: 118327201 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCGGAGGTCAGAGTTGCCTACA Rv primer used for cloning: CATGGATTCAGGCCATTCCTGTCA
Proper citation: RRID:Addgene_60293 Copy
Species: Homo sapiens
Genetic Insert: EDN3 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr20; start: 57374048 end: 57374748 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCCATTCAGAAGCCCTTTCC Rv primer used for cloning: TTCTGCACCCAGCTTTGTAAGAGG
Proper citation: RRID:Addgene_60298 Copy
Species: Homo sapiens
Genetic Insert: CDKAL1 enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr6; start: 20799028 end: 20800286 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCTGAGAGCGGATTTTACAGAT Rv primer used for cloning: AGCAAAAGCTGCCATGCCTA
Proper citation: RRID:Addgene_60297 Copy
Species: Homo sapiens
Genetic Insert: CDKN2BAS enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr9; start: 22123613 end: 22124279 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCTCTGCATAAATTCTTTGGAACA Rv primer used for cloning: GATCCACCCACCTTGGTTTCC
Proper citation: RRID:Addgene_60296 Copy
Species: Homo sapiens
Genetic Insert: Argonaute2
Vector Backbone Description: Backbone Size:13918; Vector Backbone:pSLIK-Hygro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22503104
Proper citation: RRID:Addgene_60234 Copy
Species: Homo sapiens
Genetic Insert: KIF17
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24633327
Proper citation: RRID:Addgene_60406 Copy
Species: Homo sapiens
Genetic Insert: Venus-oLID-Mito
Vector Backbone Description: Vector Backbone:pLentiLox7.0; Vector Types:Mammalian Expression, Lentiviral, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535392
Proper citation: RRID:Addgene_60414 Copy
Species: Homo sapiens
Genetic Insert: hITSN1-tgRFPt-SSPB
Vector Backbone Description: Vector Backbone:pLentiLox7.0; Vector Types:Mammalian Expression, Lentiviral, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535392
Comments: The SspB used in this construct contains two amino acid mutations that disrupt the natural dimerization of SspB. These mutations are Y11K and A15E (residue numbering from pdb code 1ou9). Here is the sequence around the mutated residues with the sites of mutation in parentheses: SSPKRP(K)LLR(E)YYDWLVDNS
Proper citation: RRID:Addgene_60420 Copy
Species: Homo sapiens
Genetic Insert: KLF2
Vector Backbone Description: Backbone Marker:Dr. Hitoshi Niwa; Vector Backbone:hCMV1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25215486
Proper citation: RRID:Addgene_60433 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.