Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Authority:addgene (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

177,820 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
3xFLAG-dCas9/pCMV-7.1
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_47948 3xFLAG-dCas9 Ampicillin PMID:23942116 This plasmid can be used to isolate specific genomic regions of interest using a catalytically inactive Cas9 fused with a tag(s). Purify: locus-specific chromatin immunoprecipitation (enChIP) This system is compatible with gRNA_cloning_vector (www.addgene.org/41824) from the Church lab. Additional information and protocols can be found at: http://www.med.hirosaki-u.ac.jp/~bgb/iChIP_protocols/index_e.html Backbone Marker:Sigma-Aldrich; Backbone Size:4636; Vector Backbone:pCMV-7.1; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin human codon-optimized, D10A + H840A (catalytically inactive) 2026-08-15 01:15:46 12
pMB66
 
Resource Report
Resource Website
RRID:Addgene_47946 Cas9 Synthetic Ampicillin PMID:23979586 To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail. Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:46 0
pCMV rat SAPAP1
 
Resource Report
Resource Website
RRID:Addgene_47940 SAPAP1 Rattus norvegicus Ampicillin PMID:9115257 Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:47 0
pMB62
 
Resource Report
Resource Website
RRID:Addgene_47944 Cas9 Synthetic Ampicillin PMID:23979586 To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail. Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:47 0
pMB63
 
Resource Report
Resource Website
RRID:Addgene_47945 Cas9 Synthetic Ampicillin PMID:23979586 To generate the unique SpeI site, a short, 37 bp, linker was inserted into an existing NdeI site. This linker seems to have been inserted 2 or more times, creating a short repeat region that we have been unable to sequence across. Sequencing with the M13 reverse primer will fail. Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBluescript SK+; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:46 0
pMB70
 
Resource Report
Resource Website
RRID:Addgene_47943 guide RNA Synthetic Kanamycin PMID:23979586 Backbone Marker:Geneart; Vector Backbone:pMK; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:15:46 0
pClneoMyc MOB1 T35A
 
Resource Report
Resource Website
RRID:Addgene_47937 MOB1A Homo sapiens Ampicillin PMID:19919647 Backbone Marker:Promega; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin T35A 2026-08-15 01:15:47 0
pClneoMyc human CIN85
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_47935 CIN85 Homo sapiens Ampicillin PMID:16751601 The CIN85 insert in this plasmid contains a D114G mutation when compared to GenBank accession number NP_114098.1. This mutation was not intentional and was present in the original CIN85 clone. Backbone Marker:Promega; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contains amino acids 2-665 of human CIN85; D114G 2026-08-15 01:15:45 2
pClneoMyc MOB1 T12A
 
Resource Report
Resource Website
RRID:Addgene_47936 MOB1A Homo sapiens Ampicillin PMID:19919647 Backbone Marker:Promega; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin T12A 2026-08-15 01:15:45 0
pRK5-myc-Miro2 A13V
 
Resource Report
Resource Website
RRID:Addgene_47896 Miro2 A13V Homo sapiens Ampicillin PMID:16630562 Backbone Marker:Dr. Alan Hall, MRC-LMCB; Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin A13V, constitutively active mutant 2026-08-15 01:15:45 0
pRK5-myc-Miro2 T18N
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_47897 Miro2 T18N Homo sapiens Ampicillin PMID:16630562 Backbone Marker:Dr. Alan Hall, MRC-LMCB; Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin T18N, dominant negative mutant 2026-08-15 01:15:45 1
pT7goldRNA
 
Resource Report
Resource Website
RRID:Addgene_47930 golden gRNA Danio rerio Ampicillin PMID:23918387 For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ gRNA target sequence GGTCTCTCGCAGGATGTTGC Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 0
pRK5-myc-Miro1 E208K/E328K
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_47894 Miro1 E208K/E328K Homo sapiens Ampicillin PMID:16630562 Backbone Marker:Dr. Alan Hall, MRC-LMCB; Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin E208K/E328K, abolishes calcium binding 2026-08-15 01:15:45 3
pIK86
 
Resource Report
Resource Website
RRID:Addgene_47933 Cas9 Synthetic Ampicillin PMID:23979578 Backbone Size:2730; Vector Backbone:pUC57; Vector Types:CRISPR, Unspecified; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 0
pClneoFLAG human Dendrin
 
Resource Report
Resource Website
RRID:Addgene_47934 Dendrin-1 Homo sapiens Ampicillin PMID:16751601 Backbone Marker:Promega; Vector Backbone:pCI-neo (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contains amino acids 2-711 of human Dendrin 2026-08-15 01:15:47 0
pT7mitfagRNA
 
Resource Report
Resource Website
RRID:Addgene_47931 mitfa gRNA Danio rerio Ampicillin PMID:23918387 For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ gRNA target sequence GGTCTCTCGCAGGATGTTGC Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:47 0
pT7ddx19gRNA
 
Resource Report
Resource Website
RRID:Addgene_47932 ddx19 gRNA Danio rerio Ampicillin PMID:23918387 For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/ gRNA target sequence GGCAACAGATTCGTGGGCCC Backbone Size:2542; Vector Backbone:pT7-gRNA; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 0
pRK5-myc-Miro2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_47891 Miro2 Homo sapiens Ampicillin PMID:12482879 Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:45 9
pET22b-EC12-129/138
 
Resource Report
Resource Website
RRID:Addgene_47926 E-Cadherin EC12 Mus musculus Ampicillin PMID:23923816 Plasmid contains E-Cadherin domains 1 and 2 (aa157-375, when compared to GenBank reference sequence NP_033994.1). Numbering of the mutations is relative to this sequence. The pro-peptide sequence that is normally cleaved during maturation was intentionally removed as part of the cloning strategy for expression in bacteria. Backbone Marker:Novagen; Backbone Size:5406; Vector Backbone:pET-22b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Mutations C9A, K129C, D138C 2026-08-15 01:15:45 0
pET22b-EC12WTC9A
 
Resource Report
Resource Website
RRID:Addgene_47924 E-Cadherin EC12 Mus musculus Ampicillin PMID:23923816 Plasmid contains E-Cadherin domains 1 and 2 (aa157-375, when compared to GenBank reference sequence NP_033994.1). Numbering of the mutation is relative to this sequence. The pro-peptide sequence that is normally cleaved during maturation was intentionally removed as part of the cloning strategy for expression in bacteria. Backbone Marker:Novagen; Backbone Size:5406; Vector Backbone:pET-22b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin changed Cysteine 9 to Alanine 2026-08-15 01:15:45 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.