Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pSIN4-EF1a-ETV2-IRES-Puro Resource Report Resource Website 1+ mentions |
RRID:Addgene_61061 | ETV2 | Homo sapiens | Ampicillin | PMID:25019369 | Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 6 | ||
|
pSIN4-EF1a-TAL1-IRES-Puro Resource Report Resource Website 1+ mentions |
RRID:Addgene_61065 | TAL1 | Homo sapiens | Ampicillin | PMID:25019369 | Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 1 | ||
|
pCDNA3-V5-PTPN14-PPxY Resource Report Resource Website 1+ mentions |
RRID:Addgene_61006 | PTPN14 PPxY mutation | Homo sapiens | Ampicillin | PMID:25023289 | Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | PPxY mutation | 2026-08-15 01:17:38 | 1 | |
|
pCDNA3-V5-PTPN14-del-C Resource Report Resource Website 1+ mentions |
RRID:Addgene_61005 | PTPN14 delete C | Homo sapiens | Ampicillin | PMID:25023289 | Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deleted amino acids 934-1187 | 2026-08-15 01:17:38 | 2 | |
|
pCDNA3-V5-PTPN14-del-N Resource Report Resource Website 1+ mentions |
RRID:Addgene_61004 | PTPN14 delete N | Homo sapiens | Ampicillin | PMID:25023289 | Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deleted amino acids 17-310 | 2026-08-15 01:17:38 | 2 | |
|
pCDNA3-V5-PTPN14-wild type Resource Report Resource Website 1+ mentions |
RRID:Addgene_61003 | PTPN14 | Homo sapiens | Ampicillin | PMID:25023289 | Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 2 | ||
|
UbcH5A Resource Report Resource Website 1+ mentions |
RRID:Addgene_61081 | UbcH5A | Homo sapiens | Ampicillin | PMID:23955022 | Backbone Marker:Novagen, modified; Backbone Size:6000; Vector Backbone:PETSUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:39 | 2 | ||
|
pUC-H1-gRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_61089 | H1 promoter; gRNA sequences | Homo sapiens | Ampicillin | PMID:25209046 | As Ampicillin gene and H1 promoter contain BsaI sites, we mutated the sequence of Amp gene (G1601C, not change amino acid), and mutated H1 promoter from GAGACC to GAGGACC to eliminate the BsaI internal site. | Backbone Size:2636; Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, /Cas9 gRNA cloning vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 2 | |
|
pUC19_TTE1564 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61000 | TTE1564 transcript | Thermoanaerobacter tengcongensis MB4 | Ampicillin | PMID:26781350 | Backbone Size:2700; Vector Backbone:pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 1 | ||
|
GB-NES Resource Report Resource Website 1+ mentions |
RRID:Addgene_61017 | ddGFP B | Synthetic | Ampicillin | PMID:25622108 | Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 4 | ||
|
pBTR(hCc) Resource Report Resource Website 1+ mentions |
RRID:Addgene_61026 | horse cytochrome c | Equus* | Ampicillin | PMID:11437597 | Notes from depositor: CYC3 encodes the enzyme, which we call heme lysase in the paper, that covalently attaches the heme to the apocytochrome c. That is, the plasmid has BOTH the CYC3 gene and the structural gene for horse cytochrome c. The horse cytochrome C sequence has been codon optimized. | Backbone Marker:Multiple labs; Vector Backbone:pBTR(C102T); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | *see comments | 2026-08-15 01:17:38 | 2 |
|
pHT101-mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_61021 | Ampicillin | This vector can be used to create N- terminal or C-terminal mCherry tagged fusion proteins for expression in C. elegans. The mCherry and a modified MCS was inserted into the vector backbone using AgeI and EcoRI sites. See plasmid map and sequence for more information. Note that mCherry has been codon optimized for C. elegans expression. See pCFJ90 (Plasmid #19327) for details on the mCherry protein sequence. | Backbone Marker:Andrew Fire (Addgene plasmid #1490); Backbone Size:4526; Vector Backbone:pPD95_67; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:38 | 2 | ||||
|
pCMU-NUCr Resource Report Resource Website 1+ mentions |
RRID:Addgene_61168 | NLS-mCherry-GUS | Spectinomycin | PMID:25329881 | Vector Backbone:pKm43GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2026-08-15 01:17:39 | 4 | |||
|
pAE03 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61044 | Spectinomycin | PMID:19737355 | Vector Backbone:pJWV017; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin | 2026-08-15 01:17:38 | 1 | ||||
|
CMV-REX-GECO0.9 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61247 | REX-GECO0.9 | Synthetic | Ampicillin | PMID:25358432 | The construct is numbered based on GCaMP. | Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Substitutions relative to R-GECO1: P60R, V61W, R66W, E77V, K80E, K97R, E138V, S142P, D147V, P220L, N257I, N267D, A302P, M339L, T382S | 2026-08-15 01:17:40 | 1 |
|
CMV-ER-LAR-GECO1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_61244 | LAR-GECO1 | Synthetic | Ampicillin | PMID:25164254 | The construct is numbered based on GCaMP. | Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Substitutions relative to R-GECO1: V51W/I113V/N356S/D363Y/D381Y/F395A/V411A/L415I | 2026-08-15 01:17:40 | 17 |
|
pLentiX2-PURO-shLKB1-Hu Resource Report Resource Website 1+ mentions |
RRID:Addgene_61242 | LKB1 | Homo sapiens | Ampicillin | PMID:25042806 | Backbone Marker:Eric Campeau; Vector Backbone:pLentiX2-PURO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:40 | 2 | ||
|
pJW1219 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61250 | sgRNA(F+E) | Synthetic | Ampicillin | PMID:25491644 | target sequence: ggatggatgtgtagtcaatt | Backbone Marker:Goldstein lab; Backbone Size:8113; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:17:40 | 5 | |
|
pJW1310 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61253 | U6 promoter | Caenorhabditis elegans | Kanamycin | PMID:25491644 | Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:CRISPR, Cloning template; Bacterial Resistance:Kanamycin | 2026-08-15 01:17:40 | 1 | ||
|
pVHD Resource Report Resource Website 1+ mentions |
RRID:Addgene_61303 | Chloramphenicol and Tetracycline | PMID:25262659 | Backbone Marker:Chris Marx; Backbone Size:6878; Vector Backbone:pCM62; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Tetracycline | 2026-08-15 01:17:40 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.