Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pSIN4-EF1a-ETV2-IRES-Puro
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61061 ETV2 Homo sapiens Ampicillin PMID:25019369 Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:38 6
pSIN4-EF1a-TAL1-IRES-Puro
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61065 TAL1 Homo sapiens Ampicillin PMID:25019369 Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:38 1
pCDNA3-V5-PTPN14-PPxY
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61006 PTPN14 PPxY mutation Homo sapiens Ampicillin PMID:25023289 Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin PPxY mutation 2026-08-15 01:17:38 1
pCDNA3-V5-PTPN14-del-C
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61005 PTPN14 delete C Homo sapiens Ampicillin PMID:25023289 Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted amino acids 934-1187 2026-08-15 01:17:38 2
pCDNA3-V5-PTPN14-del-N
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61004 PTPN14 delete N Homo sapiens Ampicillin PMID:25023289 Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted amino acids 17-310 2026-08-15 01:17:38 2
pCDNA3-V5-PTPN14-wild type
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61003 PTPN14 Homo sapiens Ampicillin PMID:25023289 Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:38 2
UbcH5A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61081 UbcH5A Homo sapiens Ampicillin PMID:23955022 Backbone Marker:Novagen, modified; Backbone Size:6000; Vector Backbone:PETSUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:39 2
pUC-H1-gRNA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61089 H1 promoter; gRNA sequences Homo sapiens Ampicillin PMID:25209046 As Ampicillin gene and H1 promoter contain BsaI sites, we mutated the sequence of Amp gene (G1601C, not change amino acid), and mutated H1 promoter from GAGACC to GAGGACC to eliminate the BsaI internal site. Backbone Size:2636; Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, /Cas9 gRNA cloning vector; Bacterial Resistance:Ampicillin 2026-08-15 01:17:38 2
pUC19_TTE1564
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61000 TTE1564 transcript Thermoanaerobacter tengcongensis MB4 Ampicillin PMID:26781350 Backbone Size:2700; Vector Backbone:pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin 2026-08-15 01:17:38 1
GB-NES
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61017 ddGFP B Synthetic Ampicillin PMID:25622108 Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:38 4
pBTR(hCc)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61026 horse cytochrome c Equus* Ampicillin PMID:11437597 Notes from depositor: CYC3 encodes the enzyme, which we call heme lysase in the paper, that covalently attaches the heme to the apocytochrome c. That is, the plasmid has BOTH the CYC3 gene and the structural gene for horse cytochrome c. The horse cytochrome C sequence has been codon optimized. Backbone Marker:Multiple labs; Vector Backbone:pBTR(C102T); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin *see comments 2026-08-15 01:17:38 2
pHT101-mCherry
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61021 Ampicillin This vector can be used to create N- terminal or C-terminal mCherry tagged fusion proteins for expression in C. elegans. The mCherry and a modified MCS was inserted into the vector backbone using AgeI and EcoRI sites. See plasmid map and sequence for more information. Note that mCherry has been codon optimized for C. elegans expression. See pCFJ90 (Plasmid #19327) for details on the mCherry protein sequence. Backbone Marker:Andrew Fire (Addgene plasmid #1490); Backbone Size:4526; Vector Backbone:pPD95_67; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:17:38 2
pCMU-NUCr
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61168 NLS-mCherry-GUS Spectinomycin PMID:25329881 Vector Backbone:pKm43GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin 2026-08-15 01:17:39 4
pAE03
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61044 Spectinomycin PMID:19737355 Vector Backbone:pJWV017; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-15 01:17:38 1
CMV-REX-GECO0.9
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61247 REX-GECO0.9 Synthetic Ampicillin PMID:25358432 The construct is numbered based on GCaMP. Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Substitutions relative to R-GECO1: P60R, V61W, R66W, E77V, K80E, K97R, E138V, S142P, D147V, P220L, N257I, N267D, A302P, M339L, T382S 2026-08-15 01:17:40 1
CMV-ER-LAR-GECO1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_61244 LAR-GECO1 Synthetic Ampicillin PMID:25164254 The construct is numbered based on GCaMP. Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Substitutions relative to R-GECO1: V51W/I113V/N356S/D363Y/D381Y/F395A/V411A/L415I 2026-08-15 01:17:40 17
pLentiX2-PURO-shLKB1-Hu
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61242 LKB1 Homo sapiens Ampicillin PMID:25042806 Backbone Marker:Eric Campeau; Vector Backbone:pLentiX2-PURO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:17:40 2
pJW1219
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61250 sgRNA(F+E) Synthetic Ampicillin PMID:25491644 target sequence: ggatggatgtgtagtcaatt Backbone Marker:Goldstein lab; Backbone Size:8113; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:17:40 5
pJW1310
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61253 U6 promoter Caenorhabditis elegans Kanamycin PMID:25491644 Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:CRISPR, Cloning template; Bacterial Resistance:Kanamycin 2026-08-15 01:17:40 1
pVHD
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_61303 Chloramphenicol and Tetracycline PMID:25262659 Backbone Marker:Chris Marx; Backbone Size:6878; Vector Backbone:pCM62; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Tetracycline 2026-08-15 01:17:40 2

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch