Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: ETV2
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019369
Proper citation: RRID:Addgene_61061 Copy
Species: Homo sapiens
Genetic Insert: TAL1
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pSIN4-EF1alpha-IRES-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019369
Proper citation: RRID:Addgene_61065 Copy
Species: Homo sapiens
Genetic Insert: PTPN14 PPxY mutation
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25023289
Proper citation: RRID:Addgene_61006 Copy
Species: Homo sapiens
Genetic Insert: PTPN14 delete C
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25023289
Proper citation: RRID:Addgene_61005 Copy
Species: Homo sapiens
Genetic Insert: PTPN14 delete N
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25023289
Proper citation: RRID:Addgene_61004 Copy
Species: Homo sapiens
Genetic Insert: PTPN14
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25023289
Proper citation: RRID:Addgene_61003 Copy
Species: Homo sapiens
Genetic Insert: UbcH5A
Vector Backbone Description: Backbone Marker:Novagen, modified; Backbone Size:6000; Vector Backbone:PETSUMO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23955022
Proper citation: RRID:Addgene_61081 Copy
Species: Homo sapiens
Genetic Insert: H1 promoter; gRNA sequences
Vector Backbone Description: Backbone Size:2636; Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, /Cas9 gRNA cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25209046
Comments: As Ampicillin gene and H1 promoter contain BsaI sites, we mutated the sequence of Amp gene (G1601C, not change amino acid), and mutated H1 promoter from GAGACC to GAGGACC to eliminate the BsaI internal site.
Proper citation: RRID:Addgene_61089 Copy
Species: Thermoanaerobacter tengcongensis MB4
Genetic Insert: TTE1564 transcript
Vector Backbone Description: Backbone Size:2700; Vector Backbone:pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26781350
Proper citation: RRID:Addgene_61000 Copy
Species: Synthetic
Genetic Insert: ddGFP B
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25622108
Proper citation: RRID:Addgene_61017 Copy
Species: Equus*
Genetic Insert: horse cytochrome c
Vector Backbone Description: Backbone Marker:Multiple labs; Vector Backbone:pBTR(C102T); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11437597
Comments: Notes from depositor: CYC3 encodes the enzyme, which we call heme lysase in the paper, that covalently attaches the heme to the apocytochrome c. That is, the plasmid has BOTH the CYC3 gene and the structural gene for horse cytochrome c. The horse cytochrome C sequence has been codon optimized.
Proper citation: RRID:Addgene_61026 Copy
Vector Backbone Description: Backbone Marker:Andrew Fire (Addgene plasmid #1490); Backbone Size:4526; Vector Backbone:pPD95_67; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: This vector can be used to create N- terminal or C-terminal mCherry tagged fusion proteins for expression in C. elegans. The mCherry and a modified MCS was inserted into the vector backbone using AgeI and EcoRI sites. See plasmid map and sequence for more information.
Note that mCherry has been codon optimized for C. elegans expression. See pCFJ90 (Plasmid #19327) for details on the mCherry protein sequence.
Proper citation: RRID:Addgene_61021 Copy
Genetic Insert: NLS-mCherry-GUS
Vector Backbone Description: Vector Backbone:pKm43GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:25329881
Proper citation: RRID:Addgene_61168 Copy
Vector Backbone Description: Vector Backbone:pJWV017; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:19737355
Proper citation: RRID:Addgene_61044 Copy
Species: Synthetic
Genetic Insert: REX-GECO0.9
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25358432
Comments: The construct is numbered based on GCaMP.
Proper citation: RRID:Addgene_61247 Copy
Species: Synthetic
Genetic Insert: LAR-GECO1
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25164254
Comments: The construct is numbered based on GCaMP.
Proper citation: RRID:Addgene_61244 Copy
Species: Homo sapiens
Genetic Insert: LKB1
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pLentiX2-PURO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25042806
Proper citation: RRID:Addgene_61242 Copy
Species: Synthetic
Genetic Insert: sgRNA(F+E)
Vector Backbone Description: Backbone Marker:Goldstein lab; Backbone Size:8113; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25491644
Comments: target sequence: ggatggatgtgtagtcaatt
Proper citation: RRID:Addgene_61250 Copy
Species: Caenorhabditis elegans
Genetic Insert: U6 promoter
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3519; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:CRISPR, Cloning template; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25491644
Proper citation: RRID:Addgene_61253 Copy
Vector Backbone Description: Backbone Marker:Chris Marx; Backbone Size:6878; Vector Backbone:pCM62; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Tetracycline
Defining Citation: PMID:25262659
Proper citation: RRID:Addgene_61303 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
