Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pGEX Grb14-SH2 Resource Report Resource Website |
RRID:Addgene_46439 | Grb14 | Homo sapiens | Ampicillin | PMID:17588523 | The molecular weight of the GST fusion protein is approximately 38.5 kDa | Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains amino acids 427-540 | 2026-08-15 01:15:31 | 0 |
|
pGEX RASGAP(NC)-SH2 Resource Report Resource Website |
RRID:Addgene_46433 | Gap/RASGAP(NC) | Homo sapiens | Ampicillin | PMID:17588523 | The molecular weight of the GST fusion protein is approximately 54.5 kDa | Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains amino acids 171-448 | 2026-08-15 01:15:31 | 0 |
|
pGEX Grap-SH2 Resource Report Resource Website |
RRID:Addgene_46434 | Grap | Homo sapiens | Ampicillin | PMID:17588523 | The molecular weight of the GST fusion protein is approximately 38.1 kDa | Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains amino acids 51-160 | 2026-08-15 01:15:31 | 0 |
|
pGEX RASGAP(N)-SH2 Resource Report Resource Website |
RRID:Addgene_46432 | Gap/RASGAP(N) | Homo sapiens | Ampicillin | PMID:17588523 | The molecular weight of the GST fusion protein is approximately 38.7 kDa | Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains amino acids 168-283 | 2026-08-15 01:15:32 | 0 |
|
pGEX Grb10-PIR-SH2 Resource Report Resource Website |
RRID:Addgene_46436 | Grb10 | Homo sapiens | Ampicillin | PMID:17588523 | The molecular weight of the GST fusion protein is approximately 45.8 kDa | Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains amino acids 355-548 | 2026-08-15 01:15:31 | 0 |
|
pENTR FL CPAP RNAi resistant Resource Report Resource Website |
RRID:Addgene_46390 | CPAP RNAi resistant mutant | Homo sapiens | Kanamycin | PMID:22100914 | Backbone Marker:Invitrogen; Backbone Size:2717; Vector Backbone:pENTR 1A; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | silent mutation that renders it resistant to siRNA :nucleotides 2862–2880, new sequence: 5′-AGAGTTAGCTAGGATCGAAGA-3′ | 2026-08-15 01:15:31 | 0 | |
|
pAC4 Frk-SH2 Resource Report Resource Website |
RRID:Addgene_46428 | Frk | Homo sapiens | Ampicillin | PMID:17588523 | The molecular weight of the GST fusion protein is approximately 37.1 kDa | Backbone Marker:Avidity; Backbone Size:4216; Vector Backbone:pAC4; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains amino acids 108-213 | 2026-08-15 01:15:31 | 0 |
|
pGEX FynA-SH2 Resource Report Resource Website |
RRID:Addgene_46429 | FynA | Homo sapiens | Ampicillin | PMID:17588523 | The molecular weight of the GST fusion protein is approximately 37.4 kDa | Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains amino acids 142-251 | 2026-08-15 01:15:32 | 0 |
|
pGEX Eat2-SH2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46423 | Eat2 | Homo sapiens | Ampicillin | PMID:17588523 | The molecular weight of the GST fusion protein is approximately 39.6 kDa | Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains amino acids 1-132 | 2026-08-15 01:15:32 | 1 |
|
pGEX Cten-SH2 Resource Report Resource Website |
RRID:Addgene_46421 | Cten | Homo sapiens | Ampicillin | PMID:17588523 | The molecular weight of the GST fusion protein is approximately 39.1 kDa | Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains amino acids 444-570 | 2026-08-15 01:15:31 | 0 |
|
pGEX Fgr-SH2 Resource Report Resource Website |
RRID:Addgene_46427 | Fgr | Homo sapiens | Ampicillin | PMID:17588523 | The molecular weight of the GST fusion protein is approximately 37.3 kDa | Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains amino acids 137-245 | 2026-08-15 01:15:31 | 0 |
|
pGEX Emt-SH2 Resource Report Resource Website |
RRID:Addgene_46424 | Emt | Homo sapiens | Ampicillin | PMID:17588523 | The molecular weight of the GST fusion protein is approximately 38.8 kDa | Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains amino acids 223-346 | 2026-08-15 01:15:31 | 0 |
|
pcDNA3.1 EWS-myc-HIS Resource Report Resource Website 1+ mentions |
RRID:Addgene_46386 | EWSR1 | Homo sapiens | Ampicillin | PMID:18320585 | EWS cDNA was amplified by PCR using XhoI-NotI-forward and EcoRI-reverse primers 5-TCTCTCGAGCG GCCGCGCCACCATGGCGTCCACGGATTACAGTACC-3 5-CCGAATTCGTAGGGCCGATCTCTGCGCTCCTG-3, respectively. | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(-)B/myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:31 | 1 | |
|
pGEX-6p-2-EWSR1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46384 | EWSR1 | Homo sapiens | Ampicillin | PMID:16044463 | The EWS cDNA23 was PCR-amplified using primers ATCTGGAATTCAAATGGCGTCCACGGATTACAGTACCTATAGCCAAGCTGCAGC and CTGGTAGTCAATGCAGCTCGAGGGGGTCTCTGCATCTAGTAGG. | Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX-6p-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:31 | 1 | |
|
pGEX Crk-SH2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46418 | Crk | Homo sapiens | Ampicillin | PMID:17588523 | The molecular weight of the GST fusion protein is approximately 38.9 kDa | Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains amino acids 1-124 | 2026-08-15 01:15:31 | 2 |
|
pGEX chimerin-SH2 Resource Report Resource Website |
RRID:Addgene_46415 | chimerin | Homo sapiens | Ampicillin | PMID:17588523 | The molecular weight of the GST fusion protein is approximately 36.8 kDa | Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains amino acids 44-147 | 2026-08-15 01:15:31 | 0 |
|
pGEX chimerin2-SH2 Resource Report Resource Website |
RRID:Addgene_46416 | chimerin2 | Homo sapiens | Ampicillin | PMID:17588523 | The molecular weight of the GST fusion protein is approximately 37.1 kDa | Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains amino acids 49-155 | 2026-08-15 01:15:31 | 0 |
|
pGL3-B-pGAS5 Resource Report Resource Website |
RRID:Addgene_46371 | GAS5 | Homo sapiens | Ampicillin | PMID:24885398 | This promoter from a cancer line expressing high levels of GAS5 and contains two mismatches in the GAS5 region. | Backbone Marker:promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | promoter | 2026-08-15 01:15:31 | 0 |
|
pGEX Blnk-SH2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46408 | Blnk | Homo sapiens | Ampicillin | PMID:17588523 | The molecular weight of the GST fusion protein is approximately 39.5 kDa | Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains amino acids 333-456 | 2026-08-15 01:15:31 | 2 |
|
pGEX Bks-SH2 Resource Report Resource Website |
RRID:Addgene_46406 | Bks | Homo sapiens | Ampicillin | PMID:17588523 | The molecular weight of the GST fusion protein is approximately 39 kDa | Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains amino acids 141-266 | 2026-08-15 01:15:31 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.