Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pEBG‐AMPK
α1(1‐312) Resource Report Resource Website 10+ mentions |
RRID:Addgene_27632 | AMPK α1(1‐312) | Rattus norvegicus | Ampicillin | PMID:21205641 | This plasmid was first described in the following article: Crute et al. Functional domains of the alpha1 catalytic subunit of the AMP-activated protein kinase. J Biol Chem (1998) vol. 273 (52) pp. 35347-54. | Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Constitutively active by truncation after amino acid 312. | 2026-08-15 01:13:05 | 12 |
|
rEgr3/LZRS Resource Report Resource Website |
RRID:Addgene_27785 | Egr3 | Rattus norvegicus | Ampicillin | Backbone Marker:A.Q. Bakker; Backbone Size:12443; Vector Backbone:LZRSpBMN-linker-IRES-EGFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:07 | 0 | |||
|
CALNL-DCX-eGFP Resource Report Resource Website |
RRID:Addgene_28310 | Doublecortin | Rattus norvegicus | Ampicillin | PMID:19098909 | Backbone Marker:Addgene plasmid 13770; Backbone Size:4698; Vector Backbone:CALNL-eGFP; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:13 | 0 | ||
|
TSC2-S1345A Resource Report Resource Website |
RRID:Addgene_29358 | TSC2 | Rattus norvegicus | Ampicillin | PMID:14651849 | Backbone Size:0; Vector Backbone:pCDNA3-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S1345A (equivalent to S1389A in rat TSC2 isoform 1) | 2026-08-15 01:13:18 | 0 | |
|
pRc/CMV HA TrkB Resource Report Resource Website 1+ mentions |
RRID:Addgene_39978 | TrkB | Rattus norvegicus | Ampicillin | PMID:9927421 | cloned in the pRC/CMV AC7 vector, a derivative of the pRC/CMV vector (Invitrogen), which contains the BM40 signal peptide Please note that the endogenous signal sequence of TrkB was replaced by the BM40 signal peptide sequence (MRAWIFFLLCLAGRALAAPLA). When compared to translated sequences for GenBank ID M55291.1 or NM_012731.2, the TrkB protein sequence starts at amino acid #32 | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pRC/CMV AC7 vector, a derivative of the pRC/CMV vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | endogenous signal sequence was replaced with BM40 and HA tag | 2026-08-15 01:14:32 | 2 |
|
pCMV Myc rat SAPAP3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_40217 | SAPAP3 | Rattus norvegicus | Ampicillin | PMID:9115257 | Vector Backbone:pCMV5 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:34 | 1 | ||
|
pCIneoMyc rat SAPAP1 Resource Report Resource Website |
RRID:Addgene_40215 | SAPAP1 | Rattus norvegicus | Ampicillin | PMID:9115257 | Please note that after the stop codon of SAPAP1 and before the NotI site Addgene's sequencing results identified an untranslated portion of Cnksr2 (amino acids 850-1028 when compared GenBank ID NP_001106837.1) | Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:34 | 0 | |
|
prLCA-Citrine Resource Report Resource Website |
RRID:Addgene_40271 | Clta | Rattus norvegicus | Kanamycin | PMID:17956594 | Backbone Marker:Clontech; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:35 | 0 | ||
|
pcDNA3-Camui-CR Resource Report Resource Website 1+ mentions |
RRID:Addgene_40256 | Camuiα-CR | Rattus norvegicus | Ampicillin | PMID:22961245 | Venus was replaced with GFP Clover and CFP S175G was replaced with RFP mRuby2. | Backbone Marker:Invitrogen; Backbone Size:5320; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:35 | 3 | |
|
pGP-CMV-GCaMP6f Resource Report Resource Website 100+ mentions |
RRID:Addgene_40755 | GCaMP6f | Rattus norvegicus | Kanamycin | PMID:23868258 | Backbone Marker:Clontech; Backbone Size:3955; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:38 | 116 | ||
|
pGP-CMV-GCaMP6m Resource Report Resource Website 50+ mentions |
RRID:Addgene_40754 | GCaMP6m | Rattus norvegicus | Kanamycin | PMID:23868258 | Backbone Marker:Clontech; Backbone Size:3955; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:38 | 61 | ||
|
pCMV5-rat ERK2-D319N Resource Report Resource Website 1+ mentions |
RRID:Addgene_40820 | MAPK1 | Rattus norvegicus | Ampicillin | PMID:11591711 | Backbone Marker:David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | D319N | 2026-08-15 01:14:39 | 1 | |
|
Erk2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_40777 | Erk2 | Rattus norvegicus | Ampicillin | PMID:24704509 | Backbone Size:6000; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Starting Met removed | 2026-08-15 01:14:38 | 1 | |
|
FuPick-shRNA Resource Report Resource Website |
RRID:Addgene_31614 | PICK1 shRNA | Rattus norvegicus | Ampicillin | PMID:21147983 | PICK1 shRNA: CTATGAGTACCGCCTTATCCT | Backbone Size:9000; Vector Backbone:FUGW+H; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:35 | 0 | |
|
GFP-PICK Resource Report Resource Website 1+ mentions |
RRID:Addgene_31613 | PICK1 (shRNA insensitive) +shRNA towards PICK1 | Rattus norvegicus | Ampicillin | PMID:21147983 | This is the replacement construct which expresses an shRNA to knockdown the endogenous protein and a recombinant GFP-tagged, shRNA-resistant protein, to replace the endogenous PICK1. shRNA sequence: CTATGAGTACCGCCTTATCCT | Backbone Marker:David Baltimore (Caltech); Backbone Size:9941; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:38 | 1 | |
|
pcDNA5FRT/TO-p97-AE-mycStrep Resource Report Resource Website |
RRID:Addgene_31841 | p97 | Rattus norvegicus | Ampicillin | PMID:21822278 | Contains NMHTG linker between myc and Strep tags. The hygromycin resistance gene in this plasmid lacks a promoter and native start codon. See Invitrogen's website for more information about the vector backbone. | Backbone Marker:Invitrogen; Backbone Size:5137; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin | A232E | 2026-08-15 01:13:36 | 0 |
|
CD200Cd4d3+4-blac Resource Report Resource Website |
RRID:Addgene_32405 | CD200 | Rattus norvegicus | Ampicillin | PMID:18296487 | Backbone Marker:Mark Bushell; Backbone Size:6000; Vector Backbone:pEMCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:41 | 0 | ||
|
CD200RCd4d3+4-bio Resource Report Resource Website |
RRID:Addgene_32406 | CD200 Receptor extracellular domain | Rattus norvegicus | Ampicillin | PMID:18296487 | Backbone Marker:Mark Bushell; Backbone Size:6000; Vector Backbone:pEMCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:45 | 0 | ||
|
CD200Cd4d3+4-bio Resource Report Resource Website |
RRID:Addgene_32404 | CD200 | Rattus norvegicus | Ampicillin | PMID:18296487 | Please note that Addgene's sequencing result with the LNCX primer found a single nucleotide mismatch at bp# 6587 when compared to the full plasmid sequence provided by the depositing scientist. According to the depositing scientist, the mismatch is in the Kozak sequence preceding the CD200bio open reading frame and should not affect protein expression. | Backbone Marker:Mark Bushell; Backbone Size:6000; Vector Backbone:pEMCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:41 | 0 | |
|
CD200RCd4d3+4-blac Resource Report Resource Website |
RRID:Addgene_32407 | CD200 Receptor extracellular domain | Rattus norvegicus | Ampicillin | PMID:18296487 | Backbone Marker:Mark Bushell; Backbone Size:6000; Vector Backbone:pEMCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:41 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
