Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: AMPK
α1(1‐312)
Vector Backbone Description: Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21205641
Comments: This plasmid was first described in the following article: Crute et al. Functional domains of the alpha1 catalytic subunit of the AMP-activated protein kinase. J Biol Chem (1998) vol. 273 (52) pp. 35347-54.
Proper citation: RRID:Addgene_27632 Copy
Species: Rattus norvegicus
Genetic Insert: Egr3
Vector Backbone Description: Backbone Marker:A.Q. Bakker; Backbone Size:12443; Vector Backbone:LZRSpBMN-linker-IRES-EGFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_27785 Copy
Species: Rattus norvegicus
Genetic Insert: Doublecortin
Vector Backbone Description: Backbone Marker:Addgene plasmid 13770; Backbone Size:4698; Vector Backbone:CALNL-eGFP; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19098909
Proper citation: RRID:Addgene_28310 Copy
Species: Rattus norvegicus
Genetic Insert: TSC2
Vector Backbone Description: Backbone Size:0; Vector Backbone:pCDNA3-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14651849
Proper citation: RRID:Addgene_29358 Copy
Species: Rattus norvegicus
Genetic Insert: TrkB
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pRC/CMV AC7 vector, a derivative of the pRC/CMV vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9927421
Comments: cloned in the pRC/CMV AC7 vector, a derivative of the pRC/CMV vector (Invitrogen), which contains the BM40 signal peptide
Please note that the endogenous signal sequence of TrkB was replaced by the BM40 signal peptide sequence (MRAWIFFLLCLAGRALAAPLA). When compared to translated sequences for GenBank ID M55291.1 or NM_012731.2, the TrkB protein sequence starts at amino acid #32
Proper citation: RRID:Addgene_39978 Copy
Species: Rattus norvegicus
Genetic Insert: SAPAP3
Vector Backbone Description: Vector Backbone:pCMV5 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9115257
Proper citation: RRID:Addgene_40217 Copy
Species: Rattus norvegicus
Genetic Insert: SAPAP1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9115257
Comments: Please note that after the stop codon of SAPAP1 and before the NotI site Addgene's sequencing results identified an untranslated portion of Cnksr2 (amino acids 850-1028 when compared GenBank ID NP_001106837.1)
Proper citation: RRID:Addgene_40215 Copy
Species: Rattus norvegicus
Genetic Insert: Clta
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17956594
Proper citation: RRID:Addgene_40271 Copy
Species: Rattus norvegicus
Genetic Insert: Camuiα-CR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5320; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22961245
Comments: Venus was replaced with GFP Clover and CFP S175G was replaced with RFP mRuby2.
Proper citation: RRID:Addgene_40256 Copy
Species: Rattus norvegicus
Genetic Insert: GCaMP6f
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3955; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23868258
Proper citation: RRID:Addgene_40755 Copy
Species: Rattus norvegicus
Genetic Insert: GCaMP6m
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3955; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23868258
Proper citation: RRID:Addgene_40754 Copy
Species: Rattus norvegicus
Genetic Insert: MAPK1
Vector Backbone Description: Backbone Marker:David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11591711
Proper citation: RRID:Addgene_40820 Copy
Species: Rattus norvegicus
Genetic Insert: Erk2
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24704509
Proper citation: RRID:Addgene_40777 Copy
Species: Rattus norvegicus
Genetic Insert: PICK1 shRNA
Vector Backbone Description: Backbone Size:9000; Vector Backbone:FUGW+H; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21147983
Comments: PICK1 shRNA: CTATGAGTACCGCCTTATCCT
Proper citation: RRID:Addgene_31614 Copy
Species: Rattus norvegicus
Genetic Insert: PICK1 (shRNA insensitive) +shRNA towards PICK1
Vector Backbone Description: Backbone Marker:David Baltimore (Caltech); Backbone Size:9941; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21147983
Comments: This is the replacement construct which expresses an shRNA to knockdown the endogenous protein and a recombinant GFP-tagged, shRNA-resistant protein, to replace the endogenous PICK1.
shRNA sequence: CTATGAGTACCGCCTTATCCT
Proper citation: RRID:Addgene_31613 Copy
Species: Rattus norvegicus
Genetic Insert: p97
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5137; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822278
Comments: Contains NMHTG linker between myc and Strep tags.
The hygromycin resistance gene in this plasmid lacks a promoter and native start codon. See Invitrogen's website for more information about the vector backbone.
Proper citation: RRID:Addgene_31841 Copy
Species: Rattus norvegicus
Genetic Insert: CD200
Vector Backbone Description: Backbone Marker:Mark Bushell; Backbone Size:6000; Vector Backbone:pEMCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18296487
Proper citation: RRID:Addgene_32405 Copy
Species: Rattus norvegicus
Genetic Insert: CD200 Receptor extracellular domain
Vector Backbone Description: Backbone Marker:Mark Bushell; Backbone Size:6000; Vector Backbone:pEMCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18296487
Proper citation: RRID:Addgene_32406 Copy
Species: Rattus norvegicus
Genetic Insert: CD200
Vector Backbone Description: Backbone Marker:Mark Bushell; Backbone Size:6000; Vector Backbone:pEMCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18296487
Comments: Please note that Addgene's sequencing result with the LNCX primer found a single nucleotide mismatch at bp# 6587 when compared to the full plasmid sequence provided by the depositing scientist. According to the depositing scientist, the mismatch is in the Kozak sequence preceding the CD200bio open reading frame and should not affect protein expression.
Proper citation: RRID:Addgene_32404 Copy
Species: Rattus norvegicus
Genetic Insert: CD200 Receptor extracellular domain
Vector Backbone Description: Backbone Marker:Mark Bushell; Backbone Size:6000; Vector Backbone:pEMCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18296487
Proper citation: RRID:Addgene_32407 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
