Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: Cer.zf1
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25628360
Proper citation: RRID:Addgene_61389 Copy
Species: Synthetic
Genetic Insert: tol1.zf1
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25628360
Proper citation: RRID:Addgene_61388 Copy
Species: Synthetic
Genetic Insert: dCAS9(D10A,H840A)-VP64_2A_GFP
Vector Backbone Description: Vector Backbone:lenti(AMP); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25494202
Comments: For additional information, protocols and an activator sgRNA design tool, visit our website:
http://sam.genome-engineering.org/
Proper citation: RRID:Addgene_61422 Copy
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25494202
Comments: For additional information, protocols and an activator sgRNA design tool, visit our website:
http://sam.genome-engineering.org/
Proper citation: RRID:Addgene_61424 Copy
Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25386923
Proper citation: RRID:Addgene_61314 Copy
Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25386923
Proper citation: RRID:Addgene_61319 Copy
Species: Synthetic
Genetic Insert: TagRFPT.zf1
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25628360
Proper citation: RRID:Addgene_61390 Copy
Species: Synthetic
Genetic Insert: Gal4ff.zf1
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25628360
Proper citation: RRID:Addgene_61392 Copy
Vector Backbone Description: Backbone Size:8626; Vector Backbone:RRL.PPT.SFFV.RFP657.IRES2.PAC.PRE; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24952903
Proper citation: RRID:Addgene_61395 Copy
Species: E. coli
Genetic Insert: SCRIBE_kanR(ON)
Vector Backbone Description: Backbone Marker:Expressys; Vector Backbone:pZE32; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25395541
Proper citation: RRID:Addgene_61450 Copy
Species: Homo sapiens
Genetic Insert: CenpB-GFP-Halo
Vector Backbone Description: Backbone Marker:Dr. Eugene Makeyev; Vector Backbone:pEM791; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25400104
Proper citation: RRID:Addgene_61502 Copy
Species: Oryza sativa
Genetic Insert: OsMIR390-B/c
Vector Backbone Description: Backbone Size:11592; Vector Backbone:pH7WG2; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:25809382
Proper citation: RRID:Addgene_61465 Copy
Species: Oryza sativa
Genetic Insert: OsMIR390-B/c
Vector Backbone Description: Backbone Size:9620; Vector Backbone:pMDC123; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Kanamycin
Defining Citation: PMID:25809382
Proper citation: RRID:Addgene_61466 Copy
Species: Homo sapiens
Genetic Insert: HaloTag-GFP-Mito
Vector Backbone Description: Backbone Marker:Dr. Eugene Makeyev; Vector Backbone:pEM791; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25400104
Proper citation: RRID:Addgene_61500 Copy
Genetic Insert: AMPK Biosensor
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25892241
Comments: Mitochondrial targeting signal (DAKAP1-30): ATGGCAATCCAGTTGCGTTCGCTCTTCCCCTTGGCGTTGCCCGGAATGCTGGCCCTCCTTGGCTGGTGGTGGTTTTTCTCTCGTAAAAAA
Proper citation: RRID:Addgene_61509 Copy
Species: Homo sapiens
Genetic Insert: PK-hLC3∆G
Vector Backbone Description: Backbone Size:9000; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25340751
Comments: We thank Dr. James Edward Rothman for providing respective pHluorin.
Proper citation: RRID:Addgene_61461 Copy
Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:4159; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24618276
Proper citation: RRID:Addgene_61462 Copy
Species: Homo sapiens
Genetic Insert: NEAT1
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4000; Vector Backbone:PCRII; Vector Types:general cloning vector; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:19217333
Comments: *To create this plasmid, hNEAT1 was amplified from HeLa cDNA. The insert contains two mismatches (C->T at bp 78, and A->G at bp 91, an A->G at bp 1666, and a deletion of TA at bp 2031 and 2032 using the numbering of NR_028272.1) compared to the canonical hNEAT1 sequence. These variants are likely to be encoded in the HeLa genome, as they appeared in multiple clones, but this is yet to be verified by sequencing of HeLa genomic DNA.
Proper citation: RRID:Addgene_61518 Copy
Species: Homo sapiens
Genetic Insert: Ngn1
Vector Backbone Description: Backbone Marker:Lab of David Baltimore; Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25403753
Proper citation: RRID:Addgene_61473 Copy
Species: Mus musculus
Genetic Insert: Ngn2
Vector Backbone Description: Backbone Marker:Lab of David Baltimore; Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25403753
Proper citation: RRID:Addgene_61471 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
