Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 74 showing 1461 ~ 1480 out of 328,630 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/45764

Species: Homo sapiens
Genetic Insert: lincRNA-RoR-shRNA1
Vector Backbone Description: Backbone Marker:Bob Weinberg; Backbone Size:7032; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21057500

Proper citation: RRID:Addgene_45764 Copy   


  • RRID:Addgene_45911

    This resource has 10+ mentions.

http://www.addgene.org/45911

Species: Homo sapiens
Genetic Insert: Syntaxin 17
Vector Backbone Description: Backbone Size:6400; Vector Backbone:CMV10 FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23217709

Proper citation: RRID:Addgene_45911 Copy   


  • RRID:Addgene_45759

    This resource has 1+ mentions.

http://www.addgene.org/45759

Species: Rattus norvegicus
Genetic Insert: AT1R DRY-AAY
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12746278
Comments: The cDNA of the rat vascular smooth muscle AT1A receptor was donated by Dr. K. E. Bernstein (Emory University, Atlanta, GA). Mutations in the rat AT1A receptor were performed with the Mutagene kit(Bio-Rad Laboratories, Inc., Hercules, CA) N4D mutation is present to prevent glycosylation at this consensus site and steric hindrance of antibody binding.

Proper citation: RRID:Addgene_45759 Copy   


  • RRID:Addgene_45913

    This resource has 1+ mentions.

http://www.addgene.org/45913

Species: Mus musculus
Genetic Insert: vesicle-associated membrane protein 7
Vector Backbone Description: Backbone Size:6400; Vector Backbone:CMV10 FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23217709

Proper citation: RRID:Addgene_45913 Copy   


  • RRID:Addgene_45918

http://www.addgene.org/45918

Species: Homo sapiens
Genetic Insert: syntaxin 18
Vector Backbone Description: Backbone Marker:Dr.Shoji Yamaoka of Tokyo Medical and Dental University; Backbone Size:6600; Vector Backbone:pMRXIP GFP-Ci2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23217709

Proper citation: RRID:Addgene_45918 Copy   


  • RRID:Addgene_45871

http://www.addgene.org/45871

Species: Mus musculus
Genetic Insert: GRP in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Comments: For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.

Proper citation: RRID:Addgene_45871 Copy   


  • RRID:Addgene_45756

http://www.addgene.org/45756

Species: Bos taurus
Genetic Insert: GRK2 S670D
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10574913
Comments: The additional C619S mutation in the Addgene QC sequence does not affect plasmid function.

Proper citation: RRID:Addgene_45756 Copy   


  • RRID:Addgene_45910

    This resource has 1+ mentions.

http://www.addgene.org/45910

Species: Homo sapiens
Genetic Insert: Syntaxin 17
Vector Backbone Description: Backbone Marker:Dr.Shoji Yamaoka of Tokyo Medical and Dental University; Backbone Size:6600; Vector Backbone:pMRXIP GFP-Ci2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23217709

Proper citation: RRID:Addgene_45910 Copy   


  • RRID:Addgene_45755

http://www.addgene.org/45755

Species: Bos taurus
Genetic Insert: GRK2 S670A
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10574913
Comments: The additional V661G mutation in the Addgene QC sequence does not affect plasmid function.

Proper citation: RRID:Addgene_45755 Copy   


  • RRID:Addgene_45868

http://www.addgene.org/45868

Species: Mus musculus
Genetic Insert: Inhba in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Inhba fragment was amplified by RT-PCR using the following primer pair: GCGATCAGAAAGCTTCATGTG AGACTGGCACCACTCTCCTG For in vitro transcription, use the Spe1 restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.

Proper citation: RRID:Addgene_45868 Copy   


  • RRID:Addgene_45900

http://www.addgene.org/45900

Species: Mus musculus
Genetic Insert: eIF2S2
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4900; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11959995

Proper citation: RRID:Addgene_45900 Copy   


  • RRID:Addgene_45869

http://www.addgene.org/45869

Species: Mus musculus
Genetic Insert: TMTC4 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19793993
Comments: The Tmtc4 fragment was amplified by RT-PCR using the following primer pair: GAAGCAGAGCAGAGCTACCG TCTGAACAGAGGCTTCATGC For in vitro transcription, use the Spe1 restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.

Proper citation: RRID:Addgene_45869 Copy   


  • RRID:Addgene_45905

    This resource has 1+ mentions.

http://www.addgene.org/45905

Species: Homo sapiens
Genetic Insert: mitochondrial antiviral signaling protein
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pFLAG-CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22427742

Proper citation: RRID:Addgene_45905 Copy   


  • RRID:Addgene_45904

http://www.addgene.org/45904

Species: Homo sapiens
Genetic Insert: mitochondrial antiviral signaling protein, mutation C508R
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pFLAG-CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22427742

Proper citation: RRID:Addgene_45904 Copy   


  • RRID:Addgene_45906

    This resource has 1+ mentions.

http://www.addgene.org/45906

Species: Homo sapiens
Genetic Insert: ZAP(S) isoform
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18225958
Comments: Contains a M202T and L388F amino acid change in the insert, not known to effect function.

Proper citation: RRID:Addgene_45906 Copy   


  • RRID:Addgene_45851

http://www.addgene.org/45851

Species: Homo sapiens
Genetic Insert: PECAM1
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23684974
Comments: Note: Compared to the current NCBI reference sequence for PECAM1, this plasmid has a V125L substitution. This is a known SNP. Also, two silent mutations were introduced to destroy two internal EcoRI sites.

Proper citation: RRID:Addgene_45851 Copy   


  • RRID:Addgene_45845

    This resource has 1+ mentions.

http://www.addgene.org/45845

Species: Mus musculus
Genetic Insert: Zfp536
Vector Backbone Description: Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23584610

Proper citation: RRID:Addgene_45845 Copy   


  • RRID:Addgene_45848

    This resource has 1+ mentions.

http://www.addgene.org/45848

Species: Mus musculus
Genetic Insert: VE-cadherin Tension Sensor
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23684974

Proper citation: RRID:Addgene_45848 Copy   


  • RRID:Addgene_45849

    This resource has 1+ mentions.

http://www.addgene.org/45849

Species: Mus musculus
Genetic Insert: VE-cadherin
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23684974

Proper citation: RRID:Addgene_45849 Copy   


  • RRID:Addgene_45844

    This resource has 1+ mentions.

http://www.addgene.org/45844

Species: Mus musculus
Genetic Insert: Olig2
Vector Backbone Description: Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23584610

Proper citation: RRID:Addgene_45844 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X