Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pLKO.1-lincRNA-RoR-sh1 (Linc-sh1) Resource Report Resource Website |
RRID:Addgene_45764 | lincRNA-RoR-shRNA1 | Homo sapiens | Ampicillin | PMID:21057500 | Backbone Marker:Bob Weinberg; Backbone Size:7032; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 0 | ||
|
FLAG-Stx17 Resource Report Resource Website 10+ mentions |
RRID:Addgene_45911 | Syntaxin 17 | Homo sapiens | Ampicillin | PMID:23217709 | Backbone Size:6400; Vector Backbone:CMV10 FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:27 | 13 | ||
|
pcDNA3.1 AT1R DRY-AAY Resource Report Resource Website 1+ mentions |
RRID:Addgene_45759 | AT1R DRY-AAY | Rattus norvegicus | Ampicillin | PMID:12746278 | The cDNA of the rat vascular smooth muscle AT1A receptor was donated by Dr. K. E. Bernstein (Emory University, Atlanta, GA). Mutations in the rat AT1A receptor were performed with the Mutagene kit(Bio-Rad Laboratories, Inc., Hercules, CA) N4D mutation is present to prevent glycosylation at this consensus site and steric hindrance of antibody binding. | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | changed amino acids 125-126 from DR to AA | 2026-08-15 01:15:26 | 1 |
|
FLAG-VAMP7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45913 | vesicle-associated membrane protein 7 | Mus musculus | Ampicillin | PMID:23217709 | Backbone Size:6400; Vector Backbone:CMV10 FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:27 | 1 | ||
|
pMRXIP GFP-Stx18 Resource Report Resource Website |
RRID:Addgene_45918 | syntaxin 18 | Homo sapiens | Ampicillin | PMID:23217709 | Backbone Marker:Dr.Shoji Yamaoka of Tokyo Medical and Dental University; Backbone Size:6600; Vector Backbone:pMRXIP GFP-Ci2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:27 | 0 | ||
|
pCRII-Topo Grp Resource Report Resource Website |
RRID:Addgene_45871 | GRP in situ probe | Mus musculus | Ampicillin | For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | nt 66-504 on NM_175012 | 2026-08-15 01:15:27 | 0 | |
|
pcDNA3 GRK2 S670D Resource Report Resource Website |
RRID:Addgene_45756 | GRK2 S670D | Bos taurus | Ampicillin | PMID:10574913 | The additional C619S mutation in the Addgene QC sequence does not affect plasmid function. | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S670D | 2026-08-15 01:15:26 | 0 |
|
pMRXIP GFP-Stx17TM Resource Report Resource Website 1+ mentions |
RRID:Addgene_45910 | Syntaxin 17 | Homo sapiens | Ampicillin | PMID:23217709 | Backbone Marker:Dr.Shoji Yamaoka of Tokyo Medical and Dental University; Backbone Size:6600; Vector Backbone:pMRXIP GFP-Ci2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | deleted amino acids 1-228 | 2026-08-15 01:15:27 | 4 | |
|
GRK2 S670A Resource Report Resource Website |
RRID:Addgene_45755 | GRK2 S670A | Bos taurus | Ampicillin | PMID:10574913 | The additional V661G mutation in the Addgene QC sequence does not affect plasmid function. | Backbone Size:4754; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S670A | 2026-08-15 01:15:26 | 0 |
|
pCRII-Topo Inhba Resource Report Resource Website |
RRID:Addgene_45868 | Inhba in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Inhba fragment was amplified by RT-PCR using the following primer pair: GCGATCAGAAAGCTTCATGTG AGACTGGCACCACTCTCCTG For in vitro transcription, use the Spe1 restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | nt 428-933 from Inhba mRNA (NM_008380.1) | 2026-08-15 01:15:27 | 0 |
|
GST eIF2beta Resource Report Resource Website |
RRID:Addgene_45900 | eIF2S2 | Mus musculus | Ampicillin | PMID:11959995 | Backbone Marker:GE Healthcare; Backbone Size:4900; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:27 | 0 | ||
|
pCRII-Topo Tmtc4 Resource Report Resource Website |
RRID:Addgene_45869 | TMTC4 in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Tmtc4 fragment was amplified by RT-PCR using the following primer pair: GAAGCAGAGCAGAGCTACCG TCTGAACAGAGGCTTCATGC For in vitro transcription, use the Spe1 restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | nt 1220-1798 on BC031368 | 2026-08-15 01:15:27 | 0 |
|
pMP31-1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45905 | mitochondrial antiviral signaling protein | Homo sapiens | Ampicillin | PMID:22427742 | Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pFLAG-CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:27 | 4 | ||
|
pMP56-5 Resource Report Resource Website |
RRID:Addgene_45904 | mitochondrial antiviral signaling protein, mutation C508R | Homo sapiens | Ampicillin | PMID:22427742 | Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pFLAG-CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | C508R | 2026-08-15 01:15:27 | 0 | |
|
pcDNA4 huZAP(S) Resource Report Resource Website 1+ mentions |
RRID:Addgene_45906 | ZAP(S) isoform | Homo sapiens | Ampicillin | PMID:18225958 | Contains a M202T and L388F amino acid change in the insert, not known to effect function. | Backbone Marker:Invitrogen; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | M202T, L388F | 2026-08-15 01:15:27 | 1 |
|
pLPCX-PECAMTL Resource Report Resource Website |
RRID:Addgene_45851 | PECAM1 | Homo sapiens | Ampicillin | PMID:23684974 | Note: Compared to the current NCBI reference sequence for PECAM1, this plasmid has a V125L substitution. This is a known SNP. Also, two silent mutations were introduced to destroy two internal EcoRI sites. | Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:27 | 0 | |
|
Tet-O-FUW-Zfp536 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45845 | Zfp536 | Mus musculus | Ampicillin | PMID:23584610 | Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 1 | ||
|
pLPCX-VEcadTS Resource Report Resource Website 1+ mentions |
RRID:Addgene_45848 | VE-cadherin Tension Sensor | Mus musculus | Ampicillin | PMID:23684974 | Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 3 | ||
|
pLPCX-VEcadTL Resource Report Resource Website 1+ mentions |
RRID:Addgene_45849 | VE-cadherin | Mus musculus | Ampicillin | PMID:23684974 | Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 2 | ||
|
Tet-O-FUW-Olig2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45844 | Olig2 | Mus musculus | Ampicillin | PMID:23584610 | Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:26 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.