Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

328,630 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pLKO.1-lincRNA-RoR-sh1 (Linc-sh1)
 
Resource Report
Resource Website
RRID:Addgene_45764 lincRNA-RoR-shRNA1 Homo sapiens Ampicillin PMID:21057500 Backbone Marker:Bob Weinberg; Backbone Size:7032; Vector Backbone:pLKO.1-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:15:26 0
FLAG-Stx17
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_45911 Syntaxin 17 Homo sapiens Ampicillin PMID:23217709 Backbone Size:6400; Vector Backbone:CMV10 FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:27 13
pcDNA3.1 AT1R DRY-AAY
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45759 AT1R DRY-AAY Rattus norvegicus Ampicillin PMID:12746278 The cDNA of the rat vascular smooth muscle AT1A receptor was donated by Dr. K. E. Bernstein (Emory University, Atlanta, GA). Mutations in the rat AT1A receptor were performed with the Mutagene kit(Bio-Rad Laboratories, Inc., Hercules, CA) N4D mutation is present to prevent glycosylation at this consensus site and steric hindrance of antibody binding. Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin changed amino acids 125-126 from DR to AA 2026-08-15 01:15:26 1
FLAG-VAMP7
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45913 vesicle-associated membrane protein 7 Mus musculus Ampicillin PMID:23217709 Backbone Size:6400; Vector Backbone:CMV10 FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:27 1
pMRXIP GFP-Stx18
 
Resource Report
Resource Website
RRID:Addgene_45918 syntaxin 18 Homo sapiens Ampicillin PMID:23217709 Backbone Marker:Dr.Shoji Yamaoka of Tokyo Medical and Dental University; Backbone Size:6600; Vector Backbone:pMRXIP GFP-Ci2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:27 0
pCRII-Topo Grp
 
Resource Report
Resource Website
RRID:Addgene_45871 GRP in situ probe Mus musculus Ampicillin For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin nt 66-504 on NM_175012 2026-08-15 01:15:27 0
pcDNA3 GRK2 S670D
 
Resource Report
Resource Website
RRID:Addgene_45756 GRK2 S670D Bos taurus Ampicillin PMID:10574913 The additional C619S mutation in the Addgene QC sequence does not affect plasmid function. Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S670D 2026-08-15 01:15:26 0
pMRXIP GFP-Stx17TM
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45910 Syntaxin 17 Homo sapiens Ampicillin PMID:23217709 Backbone Marker:Dr.Shoji Yamaoka of Tokyo Medical and Dental University; Backbone Size:6600; Vector Backbone:pMRXIP GFP-Ci2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin deleted amino acids 1-228 2026-08-15 01:15:27 4
GRK2 S670A
 
Resource Report
Resource Website
RRID:Addgene_45755 GRK2 S670A Bos taurus Ampicillin PMID:10574913 The additional V661G mutation in the Addgene QC sequence does not affect plasmid function. Backbone Size:4754; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S670A 2026-08-15 01:15:26 0
pCRII-Topo Inhba
 
Resource Report
Resource Website
RRID:Addgene_45868 Inhba in situ probe Mus musculus Ampicillin PMID:19793993 The Inhba fragment was amplified by RT-PCR using the following primer pair: GCGATCAGAAAGCTTCATGTG AGACTGGCACCACTCTCCTG For in vitro transcription, use the Spe1 restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin nt 428-933 from Inhba mRNA (NM_008380.1) 2026-08-15 01:15:27 0
GST eIF2beta
 
Resource Report
Resource Website
RRID:Addgene_45900 eIF2S2 Mus musculus Ampicillin PMID:11959995 Backbone Marker:GE Healthcare; Backbone Size:4900; Vector Backbone:pGEX-2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:27 0
pCRII-Topo Tmtc4
 
Resource Report
Resource Website
RRID:Addgene_45869 TMTC4 in situ probe Mus musculus Ampicillin PMID:19793993 The Tmtc4 fragment was amplified by RT-PCR using the following primer pair: GAAGCAGAGCAGAGCTACCG TCTGAACAGAGGCTTCATGC For in vitro transcription, use the Spe1 restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin nt 1220-1798 on BC031368 2026-08-15 01:15:27 0
pMP31-1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45905 mitochondrial antiviral signaling protein Homo sapiens Ampicillin PMID:22427742 Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pFLAG-CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:27 4
pMP56-5
 
Resource Report
Resource Website
RRID:Addgene_45904 mitochondrial antiviral signaling protein, mutation C508R Homo sapiens Ampicillin PMID:22427742 Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pFLAG-CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin C508R 2026-08-15 01:15:27 0
pcDNA4 huZAP(S)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45906 ZAP(S) isoform Homo sapiens Ampicillin PMID:18225958 Contains a M202T and L388F amino acid change in the insert, not known to effect function. Backbone Marker:Invitrogen; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin M202T, L388F 2026-08-15 01:15:27 1
pLPCX-PECAMTL
 
Resource Report
Resource Website
RRID:Addgene_45851 PECAM1 Homo sapiens Ampicillin PMID:23684974 Note: Compared to the current NCBI reference sequence for PECAM1, this plasmid has a V125L substitution. This is a known SNP. Also, two silent mutations were introduced to destroy two internal EcoRI sites. Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:27 0
Tet-O-FUW-Zfp536
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45845 Zfp536 Mus musculus Ampicillin PMID:23584610 Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:26 1
pLPCX-VEcadTS
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45848 VE-cadherin Tension Sensor Mus musculus Ampicillin PMID:23684974 Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:26 3
pLPCX-VEcadTL
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45849 VE-cadherin Mus musculus Ampicillin PMID:23684974 Backbone Marker:Clonetech; Backbone Size:6265; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:26 2
Tet-O-FUW-Olig2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45844 Olig2 Mus musculus Ampicillin PMID:23584610 Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:26 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.