Plasmids   Select Another Resource Report Type

http://www.addgene.org/17575

Species: Saccharomyces cerevisiae
Genetic Insert: GAL4
Vector Backbone Description: Backbone Size:9052; Vector Backbone:pBDP; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18621688
Comments: pBPGUw is a modular Gateway compatible GAL4 vector amenable to high throughput in vitro cloning using Invitrogen LR clonase and specific in vivo genomic targeting using PhiC31 integrase. pBPGUw contains a Drosophila synthetic core promoter (DSCP) that contains TATA, Inr, MTE, and DPE motifs. In addition the GAL4 CDS and yeast transcriptional terminator can easily be substituted for another driver by a directional 5' KpnI to 3' HindIII digest.

Proper citation: RRID:Addgene_17575 Copy   

•   Source: Addgene

http://www.addgene.org/176225

Genetic Insert: Lambda Red operon under control of PrhaB promoter and cat under control of PL promoter of lambda phage
Vector Backbone Description: Vector Backbone:pQE-30; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35920321

Proper citation: RRID:Addgene_176225 Copy   

•   Source: Addgene

http://www.addgene.org/176226

Genetic Insert: Lambda Red-T7ocr operon under control of PrhaB promoter and cat under control of PL promoter of lambda phage
Vector Backbone Description: Vector Backbone:pQE-30; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35920321

Proper citation: RRID:Addgene_176226 Copy   

•   Source: Addgene

http://www.addgene.org/176585

Genetic Insert: pRARE2 + pBADmod1-linker2-gamS plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recB deletion verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca

Proper citation: RRID:Addgene_176585 Copy   

•   Source: Addgene

http://www.addgene.org/20348

Species: cloning vector
Genetic Insert: pWS-TK2
Vector Backbone Description: Backbone Size:0; Vector Backbone:N/A; Vector Types:Mouse Targeting; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18546598
Comments: The deposited sequence file of pWS-TK2 is from compilation of previous plasmids, and only part of it has been re-sequenced. There is a gap between author's sequence and Addgene sequence that will NOT affect the use of this plasmid. Please also note that Addgene's quality control sequencing indicates that the PacI and SgfI sites present in the depositor's map are not present in the plasmid's actual sequence. pWS-TK2 is designed to have two variants of thymidine kinase gene from herpes virus.

Proper citation: RRID:Addgene_20348 Copy   

•   Source: Addgene

http://www.addgene.org/20909

Genetic Insert: Gateway Destination Vector
Vector Backbone Description: Backbone Size:9370; Vector Backbone:pBluescript KS; Vector Types:Mammalian Expression, piggyBac; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19252478

Proper citation: RRID:Addgene_20909 Copy   

•   Source: Addgene

http://www.addgene.org/36433

Genetic Insert: Gateway Cassette
Vector Backbone Description: Vector Backbone:pMartini; Vector Types:Gateway Conversion Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22848718
Comments: This vector can be used for conversion of any cloning vector into a gateway destination vector and facilitate the generation of in-frame fusions with a gateway cassette. A,B or C are reading frames; R1-R2 or R2-R1 indicate the gateway cassette orientation. Please see the associated publication for more information: Wang J-W, Beck ES, McCabe BD (2012) A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila. PLoS ONE 7(7): e42102 http://www.plosone.org/article/info:doi%2F10.1371%2Fjournal.pone.0042102

Proper citation: RRID:Addgene_36433 Copy   

•   Source: Addgene

http://www.addgene.org/36434

Genetic Insert: Gateway Cassette
Vector Backbone Description: Vector Backbone:pMartini; Vector Types:Gateway Conversion Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22848718
Comments: This vector can be used for conversion of any cloning vector into a gateway destination vector and facilitate the generation of in-frame fusions with a gateway cassette. A,B or C are reading frames; R1-R2 or R2-R1 indicate the gateway cassette orientation. Please see the associated publication for more information: Wang J-W, Beck ES, McCabe BD (2012) A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila. PLoS ONE 7(7): e42102 http://www.plosone.org/article/info:doi%2F10.1371%2Fjournal.pone.0042102

Proper citation: RRID:Addgene_36434 Copy   

•   Source: Addgene

http://www.addgene.org/36435

Genetic Insert: Gateway Cassette
Vector Backbone Description: Vector Backbone:pMartini; Vector Types:Gateway Conversion Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22848718
Comments: This vector can be used for conversion of any cloning vector into a gateway destination vector and facilitate the generation of in-frame fusions with a gateway cassette. A,B or C are reading frames; R1-R2 or R2-R1 indicate the gateway cassette orientation. Please see the associated publication for more information: Wang J-W, Beck ES, McCabe BD (2012) A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila. PLoS ONE 7(7): e42102 http://www.plosone.org/article/info:doi%2F10.1371%2Fjournal.pone.0042102

Proper citation: RRID:Addgene_36435 Copy   

•   Source: Addgene

http://www.addgene.org/36428

Genetic Insert: Gateway Cassette A R2-R1
Vector Backbone Description: Vector Backbone:pMartini; Vector Types:Gateway Conversion Vector; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22848718
Comments: This vector can be used for conversion of any cloning vector into a gateway destination vector and facilitate the generation of in-frame fusions with a gateway cassette. A,B or C are reading frames; R1-R2 or R2-R1 indicate the gateway cassette orientation. Please see the associated publication for more information: Wang J-W, Beck ES, McCabe BD (2012) A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila. PLoS ONE 7(7): e42102 http://www.plosone.org/article/info:doi%2F10.1371%2Fjournal.pone.0042102

Proper citation: RRID:Addgene_36428 Copy   

•   Source: Addgene

http://www.addgene.org/37185

Vector Backbone Description: Backbone Marker:Voytas lab (Addgene Plasmid #35397); Backbone Size:13853; Vector Backbone:pCP5; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21493687
Comments: pCP5b is a high copy derivative of pCP5 for higher DNA yield from bacteria. Plasmid used to assay TALEN function in yeast. Clone target sequences into BglII and SpeI sites as described on article. Grow yeast transformants in SD-Ura-Trp prior to assay to prevent spontaneous recombination between the lacZ fragments

Proper citation: RRID:Addgene_37185 Copy   

•   Source: Addgene

http://www.addgene.org/37626

Vector Backbone Description: Backbone Size:10184; Vector Backbone:pCXLE; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:23193063
Comments: pCEP4 is from Invitrogen. CAG Promoter was from Dr. Jun-ichi Miyazaki of Osaka University Graduate School of Medicine. In publication using this plasmid, please cite: Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193-200, 1991. Niwa, H., Yamamura, K. & Miyazaki, J. Gateway cassette is from Invitrogen.

Proper citation: RRID:Addgene_37626 Copy   

•   Source: Addgene

http://www.addgene.org/44012

Vector Backbone Description: Backbone Marker:Elledge; Backbone Size:11791; Vector Backbone:pHAGE-TRE; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21307310
Comments: pHAGE-TRE vector originally based on pHAGE-CAGS-W vector (Dr. Richard Mulligan, Harvard Institute of Medicine, Boston)

Proper citation: RRID:Addgene_44012 Copy   

•   Source: Addgene

http://www.addgene.org/43914

Vector Backbone Description: Backbone Marker:Addgene Plasmid 19778; Backbone Size:8600; Vector Backbone:FU-tet-o-hOct4; Vector Types:Mammalian Expression, Lentiviral, Gateway Destination vector, Doxycycline inducible; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:22174877
Comments: To make a drug-inducible lentiviral vector that is compatible with Gateway recombination (Invitrogen), the depositing laboratory removed the OCT4 open reading frame from FU-tetO-hOCT4 (Addgene plasmid 19778) and replaced it with a Gateway cassette cloned from pEF-DEST51 (Invitrogen) to generate FU-tetO-Gateway. ORFs that lack stop codons can be cloned into this plasmid to express proteins with a C-terminal V5 epitope tag. Please note that Addgene's sequencing results identified a single nucleotide insert between bp# 2913/2914 and single nucleotide mismatches at bp# 3303 and 4652 when compared to the full plasmid sequence provided by the depositing laboratory. These differences do not affect the function of the plasmid.

Proper citation: RRID:Addgene_43914 Copy   

•   Source: Addgene

http://www.addgene.org/114322

Vector Backbone Description: Vector Backbone:pCLX; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:29079819

Proper citation: RRID:Addgene_114322 Copy   

•   Source: Addgene

http://www.addgene.org/11478

Genetic Insert: Gateway ccdB reading frame cassette
Vector Backbone Description: Backbone Size:11600; Vector Backbone:RCASBP-Y; Vector Types:Retroviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:11759842

Proper citation: RRID:Addgene_11478 Copy   

•   Source: Addgene

http://www.addgene.org/11517

Genetic Insert: None
Vector Backbone Description: Backbone Marker:PEL; Backbone Size:9367; Vector Backbone:pDest-560; Vector Types:Bacterial Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin

Proper citation: RRID:Addgene_11517 Copy   

•   Source: Addgene

http://www.addgene.org/217453

Vector Backbone Description: Backbone Marker:https://www.addgene.org/73638/; Backbone Size:5643; Vector Backbone:pDEST-ORF-V2; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:40419795

Proper citation: RRID:Addgene_217453 Copy   

•   Source: Addgene

http://www.addgene.org/217454

Vector Backbone Description: Backbone Marker:https://www.addgene.org/73636/; Backbone Size:7371; Vector Backbone:pDEST-V2-ORF; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:40419795

Proper citation: RRID:Addgene_217454 Copy   

•   Source: Addgene

http://www.addgene.org/234713

Vector Backbone Description: Vector Backbone:pTcINDEX; Vector Types:Trypanosomatid expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:25424446
Comments: 5' Cloning Site: NruI (destroyed), 3' Cloning Site: NruI (destroyed).

Proper citation: RRID:Addgene_234713 Copy   

•   Source: Addgene