Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pBPGUw Resource Report Resource Website 10+ mentions |
RRID:Addgene_17575 | GAL4 | Saccharomyces cerevisiae | Chloramphenicol and Ampicillin | PMID:18621688 | pBPGUw is a modular Gateway compatible GAL4 vector amenable to high throughput in vitro cloning using Invitrogen LR clonase and specific in vivo genomic targeting using PhiC31 integrase. pBPGUw contains a Drosophila synthetic core promoter (DSCP) that contains TATA, Inr, MTE, and DPE motifs. In addition the GAL4 CDS and yeast transcriptional terminator can easily be substituted for another driver by a directional 5' KpnI to 3' HindIII digest. | Backbone Size:9052; Vector Backbone:pBDP; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:10:52 | 41 | |
|
pRedCm Resource Report Resource Website |
RRID:Addgene_176225 | Lambda Red operon under control of PrhaB promoter and cat under control of PL promoter of lambda phage | Chloramphenicol and Ampicillin | PMID:35920321 | Vector Backbone:pQE-30; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:10:56 | 0 | |||
|
pRedCmOcr Resource Report Resource Website |
RRID:Addgene_176226 | Lambda Red-T7ocr operon under control of PrhaB promoter and cat under control of PL promoter of lambda phage | Chloramphenicol and Ampicillin | PMID:35920321 | Vector Backbone:pQE-30; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:10:56 | 0 | |||
|
BL21 Rosetta2 ΔrecB GamS Resource Report Resource Website |
RRID:Addgene_176585 | pRARE2 + pBADmod1-linker2-gamS plasmid | Chloramphenicol and Ampicillin | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recB deletion verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin | recB genomic deletion | 2026-08-15 01:11:00 | 0 | |
|
pWS-TK2 Resource Report Resource Website |
RRID:Addgene_20348 | pWS-TK2 | cloning vector | Chloramphenicol and Ampicillin | PMID:18546598 | The deposited sequence file of pWS-TK2 is from compilation of previous plasmids, and only part of it has been re-sequenced. There is a gap between author's sequence and Addgene sequence that will NOT affect the use of this plasmid. Please also note that Addgene's quality control sequencing indicates that the PacI and SgfI sites present in the depositor's map are not present in the plasmid's actual sequence. pWS-TK2 is designed to have two variants of thymidine kinase gene from herpes virus. | Backbone Size:0; Vector Backbone:N/A; Vector Types:Mouse Targeting; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:11:53 | 0 | |
|
PB-TET Resource Report Resource Website 1+ mentions |
RRID:Addgene_20909 | Gateway Destination Vector | Chloramphenicol and Ampicillin | PMID:19252478 | Backbone Size:9370; Vector Backbone:pBluescript KS; Vector Types:Mammalian Expression, piggyBac; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:11:58 | 2 | |||
|
pMartini Gate B R1-R2 Resource Report Resource Website |
RRID:Addgene_36433 | Gateway Cassette | Chloramphenicol and Ampicillin | PMID:22848718 | This vector can be used for conversion of any cloning vector into a gateway destination vector and facilitate the generation of in-frame fusions with a gateway cassette. A,B or C are reading frames; R1-R2 or R2-R1 indicate the gateway cassette orientation. Please see the associated publication for more information: Wang J-W, Beck ES, McCabe BD (2012) A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila. PLoS ONE 7(7): e42102 http://www.plosone.org/article/info:doi%2F10.1371%2Fjournal.pone.0042102 | Vector Backbone:pMartini; Vector Types:Gateway Conversion Vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:14:10 | 0 | ||
|
pMartini Gate B R2-R1 Resource Report Resource Website |
RRID:Addgene_36434 | Gateway Cassette | Chloramphenicol and Ampicillin | PMID:22848718 | This vector can be used for conversion of any cloning vector into a gateway destination vector and facilitate the generation of in-frame fusions with a gateway cassette. A,B or C are reading frames; R1-R2 or R2-R1 indicate the gateway cassette orientation. Please see the associated publication for more information: Wang J-W, Beck ES, McCabe BD (2012) A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila. PLoS ONE 7(7): e42102 http://www.plosone.org/article/info:doi%2F10.1371%2Fjournal.pone.0042102 | Vector Backbone:pMartini; Vector Types:Gateway Conversion Vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:14:08 | 0 | ||
|
pMartini Gate C R1-R2 Resource Report Resource Website |
RRID:Addgene_36435 | Gateway Cassette | Chloramphenicol and Ampicillin | PMID:22848718 | This vector can be used for conversion of any cloning vector into a gateway destination vector and facilitate the generation of in-frame fusions with a gateway cassette. A,B or C are reading frames; R1-R2 or R2-R1 indicate the gateway cassette orientation. Please see the associated publication for more information: Wang J-W, Beck ES, McCabe BD (2012) A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila. PLoS ONE 7(7): e42102 http://www.plosone.org/article/info:doi%2F10.1371%2Fjournal.pone.0042102 | Vector Backbone:pMartini; Vector Types:Gateway Conversion Vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:14:08 | 0 | ||
|
pMartini Gate A R2-R1 Resource Report Resource Website |
RRID:Addgene_36428 | Gateway Cassette A R2-R1 | Chloramphenicol and Ampicillin | PMID:22848718 | This vector can be used for conversion of any cloning vector into a gateway destination vector and facilitate the generation of in-frame fusions with a gateway cassette. A,B or C are reading frames; R1-R2 or R2-R1 indicate the gateway cassette orientation. Please see the associated publication for more information: Wang J-W, Beck ES, McCabe BD (2012) A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila. PLoS ONE 7(7): e42102 http://www.plosone.org/article/info:doi%2F10.1371%2Fjournal.pone.0042102 | Vector Backbone:pMartini; Vector Types:Gateway Conversion Vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:14:08 | 0 | ||
|
pCP5b Resource Report Resource Website |
RRID:Addgene_37185 | Chloramphenicol and Ampicillin | PMID:21493687 | pCP5b is a high copy derivative of pCP5 for higher DNA yield from bacteria. Plasmid used to assay TALEN function in yeast. Clone target sequences into BglII and SpeI sites as described on article. Grow yeast transformants in SD-Ura-Trp prior to assay to prevent spontaneous recombination between the lacZ fragments | Backbone Marker:Voytas lab (Addgene Plasmid #35397); Backbone Size:13853; Vector Backbone:pCP5; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:14:13 | 0 | |||
|
pCXLE-gw Resource Report Resource Website 1+ mentions |
RRID:Addgene_37626 | Chloramphenicol and Ampicillin | PMID:23193063 | pCEP4 is from Invitrogen. CAG Promoter was from Dr. Jun-ichi Miyazaki of Osaka University Graduate School of Medicine. In publication using this plasmid, please cite: Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193-200, 1991. Niwa, H., Yamamura, K. & Miyazaki, J. Gateway cassette is from Invitrogen. | Backbone Size:10184; Vector Backbone:pCXLE; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:14:16 | 3 | |||
|
pInducer20 Resource Report Resource Website 100+ mentions |
RRID:Addgene_44012 | Chloramphenicol and Ampicillin | PMID:21307310 | pHAGE-TRE vector originally based on pHAGE-CAGS-W vector (Dr. Richard Mulligan, Harvard Institute of Medicine, Boston) | Backbone Marker:Elledge; Backbone Size:11791; Vector Backbone:pHAGE-TRE; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:15:12 | 228 | |||
|
FU-tetO-Gateway Resource Report Resource Website 1+ mentions |
RRID:Addgene_43914 | Chloramphenicol and Ampicillin | PMID:22174877 | To make a drug-inducible lentiviral vector that is compatible with Gateway recombination (Invitrogen), the depositing laboratory removed the OCT4 open reading frame from FU-tetO-hOCT4 (Addgene plasmid 19778) and replaced it with a Gateway cassette cloned from pEF-DEST51 (Invitrogen) to generate FU-tetO-Gateway. ORFs that lack stop codons can be cloned into this plasmid to express proteins with a C-terminal V5 epitope tag. Please note that Addgene's sequencing results identified a single nucleotide insert between bp# 2913/2914 and single nucleotide mismatches at bp# 3303 and 4652 when compared to the full plasmid sequence provided by the depositing laboratory. These differences do not affect the function of the plasmid. | Backbone Marker:Addgene Plasmid 19778; Backbone Size:8600; Vector Backbone:FU-tet-o-hOct4; Vector Types:Mammalian Expression, Lentiviral, Gateway Destination vector, Doxycycline inducible; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:15:11 | 8 | |||
|
pCLX-G4E1b-R1DESTR2-MIFE-PGK-mCherry Resource Report Resource Website |
RRID:Addgene_114322 | Chloramphenicol and Ampicillin | PMID:29079819 | Vector Backbone:pCLX; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:02:21 | 0 | ||||
|
RCASBP-Y DV Resource Report Resource Website 1+ mentions |
RRID:Addgene_11478 | Gateway ccdB reading frame cassette | Chloramphenicol and Ampicillin | PMID:11759842 | Backbone Size:11600; Vector Backbone:RCASBP-Y; Vector Types:Retroviral; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:02:26 | 5 | |||
|
pDest-566 Resource Report Resource Website 10+ mentions |
RRID:Addgene_11517 | None | Chloramphenicol and Ampicillin | Backbone Marker:PEL; Backbone Size:9367; Vector Backbone:pDest-560; Vector Types:Bacterial Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:02:31 | 27 | ||||
|
pDEST-ORF-mScarlet Resource Report Resource Website |
RRID:Addgene_217453 | Chloramphenicol and Ampicillin | PMID:40419795 | Backbone Marker:https://www.addgene.org/73638/; Backbone Size:5643; Vector Backbone:pDEST-ORF-V2; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:32:57 | 0 | ||||
|
pDEST-mScarlet-ORF Resource Report Resource Website |
RRID:Addgene_217454 | Chloramphenicol and Ampicillin | PMID:40419795 | Backbone Marker:https://www.addgene.org/73636/; Backbone Size:7371; Vector Backbone:pDEST-V2-ORF; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:32:57 | 0 | ||||
|
pTcINDEX-GW Resource Report Resource Website |
RRID:Addgene_234713 | Chloramphenicol and Ampicillin | PMID:25424446 | 5' Cloning Site: NruI (destroyed), 3' Cloning Site: NruI (destroyed). | Vector Backbone:pTcINDEX; Vector Types:Trypanosomatid expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:32:58 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
