Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 74 showing 1461 ~ 1480 out of 740,017 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/47868

Species: N meningitidis
Genetic Insert: NmCas9
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pSimpleII; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23940360

Proper citation: RRID:Addgene_47868 Copy   


  • RRID:Addgene_47866

http://www.addgene.org/47866

Species: HPV
Genetic Insert: HPV 18 E6no*
Vector Backbone Description: Backbone Size:6550; Vector Backbone:pNCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330
Comments: **The V44A mutation prevents the internal splicing of the DNA so only the "no *" (unspliced form) of 18E6 is produced.

Proper citation: RRID:Addgene_47866 Copy   


  • RRID:Addgene_47860

http://www.addgene.org/47860

Species: Synthetic
Genetic Insert: his_T_min_linker_crp_T_min double terminator
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB777; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 99% (97% and 73% alone, respectively). Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.

Proper citation: RRID:Addgene_47860 Copy   


  • RRID:Addgene_47858

http://www.addgene.org/47858

Species: Synthetic
Genetic Insert: M13_central_T_linker_rrnD_T1 double terminator
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB775; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 100% (97% and 99% alone, respectively). Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.

Proper citation: RRID:Addgene_47858 Copy   


  • RRID:Addgene_47851

http://www.addgene.org/47851

Species: Synthetic
Genetic Insert: ilvGEDA
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB768; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 99%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.

Proper citation: RRID:Addgene_47851 Copy   


  • RRID:Addgene_47857

http://www.addgene.org/47857

Species: Synthetic
Genetic Insert: BBa_B1006 U10
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB774; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 99%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.

Proper citation: RRID:Addgene_47857 Copy   


  • RRID:Addgene_47975

    This resource has 1+ mentions.

http://www.addgene.org/47975

Species: Synthetic
Genetic Insert: tdTomato
Vector Backbone Description: Backbone Marker:Martin P. Vazquez; Backbone Size:6200; Vector Backbone:pTrex-Neo; Vector Types:Trypanasoma cruzi expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20644616
Comments: Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, Tsien RY. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol. 2004;22:1567–1572 Vazquez MP, Levin MJ (1999) Functional analysis of the intergenic regions of TcP2beta gene loci allowed the construction of an improved Trypanosoma cruzi expression vector. Gene 239: 217–225. doi: 10.1016/S0378-1119(99)00386-8.

Proper citation: RRID:Addgene_47975 Copy   


  • RRID:Addgene_47855

http://www.addgene.org/47855

Species: Synthetic
Genetic Insert: tetAC terminator
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB772; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 50%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.

Proper citation: RRID:Addgene_47855 Copy   


  • RRID:Addgene_47849

http://www.addgene.org/47849

Species: Synthetic
Genetic Insert: lambda tR2 terminator
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB766; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 91%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.

Proper citation: RRID:Addgene_47849 Copy   


  • RRID:Addgene_47847

http://www.addgene.org/47847

Species: Synthetic
Genetic Insert: T7 early terminator
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB764; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 96%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.

Proper citation: RRID:Addgene_47847 Copy   


  • RRID:Addgene_47848

http://www.addgene.org/47848

Species: Synthetic
Genetic Insert: T3 early terminator
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB765; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 94%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.

Proper citation: RRID:Addgene_47848 Copy   


  • RRID:Addgene_47966

http://www.addgene.org/47966

Species: Drosophila melanogaster
Genetic Insert: Bendless
Vector Backbone Description: Backbone Size:5000; Vector Backbone:CS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19141674

Proper citation: RRID:Addgene_47966 Copy   


  • RRID:Addgene_47844

http://www.addgene.org/47844

Species: Synthetic
Genetic Insert: promoter 13 and BCD1
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: http://biofab.org/services RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 48.98

Proper citation: RRID:Addgene_47844 Copy   


  • RRID:Addgene_47955

http://www.addgene.org/47955

Species: Homo sapiens
Genetic Insert: Asunder
Vector Backbone Description: Backbone Size:5000; Vector Backbone:CS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23904267

Proper citation: RRID:Addgene_47955 Copy   


http://www.addgene.org/48080

Species: Homo sapiens
Genetic Insert: Methyl-CpG Binding Protein 2 (Rett Syndrome)
Vector Backbone Description: Backbone Size:7780; Vector Backbone:pDEST-47; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452848

Proper citation: RRID:Addgene_48080 Copy   


  • RRID:Addgene_48081

http://www.addgene.org/48081

Species: Homo sapiens
Genetic Insert: Luciferase
Vector Backbone Description: Vector Backbone:pUAS-luc2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452848

Proper citation: RRID:Addgene_48081 Copy   


  • RRID:Addgene_48076

    This resource has 1+ mentions.

http://www.addgene.org/48076

Vector Backbone Description: Backbone Marker:self-made; Backbone Size:8482; Vector Backbone:two ori derived from pUC19 and pPZP201; Vector Types:Unspecified; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21364738
Comments: level 2 vector for cloning directly from level 0

Proper citation: RRID:Addgene_48076 Copy   


  • RRID:Addgene_48074

http://www.addgene.org/48074

Vector Backbone Description: Backbone Marker:self-made; Backbone Size:4302; Vector Backbone:Backbone with three ori derived from pUC19, p15a from pACYC184 and RK2 from pBIN19; Vector Types:Unspecified; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21364738
Comments: High copy before cloning, medium copy after cloning

Proper citation: RRID:Addgene_48074 Copy   


http://www.addgene.org/48079

Species: Homo sapiens
Genetic Insert: Methyl-CpG Binding Protein 2 (Rett Syndrome)
Vector Backbone Description: Backbone Size:7780; Vector Backbone:pDEST-47; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452848

Proper citation: RRID:Addgene_48079 Copy   


  • RRID:Addgene_48070

http://www.addgene.org/48070

Vector Backbone Description: Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21364738
Comments: level 2 dummy fragment

Proper citation: RRID:Addgene_48070 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X