Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Sox10
Vector Backbone Description: Backbone Size:8377; Vector Backbone:TetO-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23584610
Proper citation: RRID:Addgene_45843 Copy
Species: Gallus gallus
Genetic Insert: TN-XXL
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pRSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19160515
Comments: TN-XXL is composed of two fluorescent proteins: cyan fluorescent protein (CFP) as the FRET donor and cpCitrine as the FRET acceptor. These proteins are linked by the calcium-sensitive double C-terminal lobe of troponin C (TnC). After the binding of free calcium, TnC undergoes a reversible conformational change that leads to energy transfer from the donor to the acceptor fluorophore, resulting in a drop in CFP fluorescence and an increase in cpCitrine fluorescence.
Proper citation: RRID:Addgene_45796 Copy
Genetic Insert: 4M5.3
Vector Backbone Description: Backbone Size:6063; Vector Backbone:pRS316; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_45831 Copy
Species: Lambda phage
Genetic Insert: gamS
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pBAD/His A; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24303785
Proper citation: RRID:Addgene_45833 Copy
Genetic Insert: miR125b sponge
Vector Backbone Description: Vector Backbone:MSCV EGFP (MG vector); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22366319
Proper citation: RRID:Addgene_45790 Copy
Species: Mus musculus
Genetic Insert: Delta ATG1-mMCL1
Vector Backbone Description: Backbone Size:6295; Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22544066
Proper citation: RRID:Addgene_45823 Copy
Species: Mus musculus
Genetic Insert: mMCL-1 Delta C22
Vector Backbone Description: Backbone Size:6295; Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22544066
Proper citation: RRID:Addgene_45820 Copy
Genetic Insert: araC
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pBEST-Luc; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_45786 Copy
Genetic Insert: deGFP
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pBEST-Luc; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_45789 Copy
Genetic Insert: Tetracycline repressor
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pBEST-Luc; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_45780 Copy
Species: Homo sapiens
Genetic Insert: FOXO1
Vector Backbone Description: Backbone Size:5729; Vector Backbone:pBabe N-terminal RFP neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21873240
Proper citation: RRID:Addgene_45813 Copy
Species: Mus musculus
Genetic Insert: Runx1
Vector Backbone Description: Backbone Marker:Weinberg Lab (Addgene plasmid 1767); Backbone Size:5300; Vector Backbone:pBabe neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21873240
Comments: pBabe HA-Runx1 neo was constructed by PCR using a mouse Runx1 template (Open Biosystems) and the following primers: GCGCAGATCTATGTACCCATACGACGTCCCAGACTACGCTGCTTCAGACAGCATTTTTGAGTC (forward), GCGCGAATTCTCAGAAGCATTCACAGTTTCC (reverse).
The PCR product was gel purified, digested with BglII and EcoRI, and then ligated into pBabe neo, which had been digested with BamHI and EcoRI and then dephosphorylated.
Proper citation: RRID:Addgene_45815 Copy
Species: Homo sapiens
Genetic Insert: FOXO1
Vector Backbone Description: Backbone Marker:Weinberg Lab (Addgene plasmid 1767); Backbone Size:5300; Vector Backbone:pBabe neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21873240
Comments: pBabe DN-FOXO1-HA-neo was constructed by PCR using a pBabe FOXO1 template (Nakamura N, et al. (2000) Mol Cell Biol 20(23):8969-8982) and the following primers: GCGCGGATCCATGGCCGAGGCGCCTCAG (forward), GCGCGTCGACTTAAGCGTAGTCTGGGACGTCGTATGGGTATGCAGCTCTTCTCCTAGGAG (reverse).
The PCR product was gel purified, digested with BamHI and SalI, and then ligated into pBabe neo, which had been digested with BamHI and SalI and then dephosphorylated.
Proper citation: RRID:Addgene_45814 Copy
Species: Mus musculus
Genetic Insert: Delta N67-mMCL-1
Vector Backbone Description: Vector Backbone:pMSCV-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22544066
Comments: Note that AA68 has been changed from Pro to Met for start codon.
Proper citation: RRID:Addgene_45819 Copy
Species: Homo sapiens
Genetic Insert: Nck-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11959995
Comments: HA-Nck1 was released from provided HA-Nck1 construct with a BamHI/EcoRI digest, subcloned into HAPCRII and then released with HindIII/EcoRI and ligated into pcDNA3. Insert contains Kozak sequence.
Proper citation: RRID:Addgene_45892 Copy
Genetic Insert: Tetracycline repressor
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pBEST-Luc; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_45778 Copy
Species: Homo sapiens
Genetic Insert: hE-cadherin/Δp120
Vector Backbone Description: Vector Backbone:pLKpac1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11381089
Comments: The three-alanine substitution present in this plasmid prevent the hE-cadherin gene product from interacting with p120 catenin.
Alternate plasmid name: hE-cadherin-762AAA-pcDNA3
Proper citation: RRID:Addgene_45770 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Vps23
Vector Backbone Description: Backbone Size:6103; Vector Backbone:YCplac111; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21505419
Proper citation: RRID:Addgene_45925 Copy
Species: Mus musculus
Genetic Insert: vesicle-associated membrane protein 7
Vector Backbone Description: Backbone Marker:Dr.Shoji Yamaoka of Tokyo Medical and Dental University; Backbone Size:6600; Vector Backbone:pMRXIP GFP-Ci2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23217709
Proper citation: RRID:Addgene_45920 Copy
Species: Homo sapiens
Genetic Insert: vesicle-associated membrane protein 8
Vector Backbone Description: Backbone Marker:Dr.Shoji Yamaoka of Tokyo Medical and Dental University; Backbone Size:6600; Vector Backbone:pMRXIP GFP-Ci2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23217709
Proper citation: RRID:Addgene_45919 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.