Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: pRARE2 + pBADmod1-linker2-gamS plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.
Primers for recB deletion verification:
Foward - tattttccagtcgtgaaagc
Reverse - ttgctgatttcttccatcag
Primers for GamS plasmid verification:
Forward - aattatgacaacttgacggctacatcattc
Reverse - cgttcaccgacaaacaaca
Proper citation: RRID:Addgene_176585 Copy
Vector Backbone Description: Backbone Size:9331; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:19657394
Comments: There are 2 gaps between depositor's reference sequence and Addgene's quality control sequence. The gaps are in vector regions only and do not affect any of the features.
Proper citation: RRID:Addgene_17451 Copy
Species: Other
Genetic Insert: EGFP
Vector Backbone Description: Vector Backbone:pBluescript II KS; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35143616
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.11.18.469106v1.full for bioRxiv preprint.
Proper citation: RRID:Addgene_182167 Copy
Species: Other
Genetic Insert: mTurquoise
Vector Backbone Description: Vector Backbone:pBluescript II KS; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35143616
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.11.18.469106v1.full for bioRxiv preprint.
Proper citation: RRID:Addgene_182169 Copy
Species: Other
Genetic Insert: EGFP
Vector Backbone Description: Vector Backbone:pBluescript II KS; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35143616
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.11.18.469106v1.full for bioRxiv preprint.
Please note: The plasmid contains an AT nucleotide deletion in the AT-repeat region of Mhc-F4-678-EGFP::GW. This deletion is not expected to have any functional consequences on the plasmid.
Proper citation: RRID:Addgene_182170 Copy
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:33000; Vector Backbone:AdenoX; Vector Types:Adenoviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21415370
Comments: He, A. and Pu, W. T. (2010) Genome-wide location analysis by pull down of in vivo biotinylated transcription factors. Curr Protoc Mol Biol Chapter 21, Unit 21.20
Please note that Addgene's sequencing results differ from the sequence provided by the depositing scientist at nucleotides 1778 and 1996. This mismatches are not known to affect plasmid function.
Proper citation: RRID:Addgene_30217 Copy
Species: Caenorhabditis elegans
Genetic Insert: ttTi4348 region
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pDESTR4-R3; Vector Types:Worm Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Unpublished MosSCI reagents from the Jorgensen lab.
This vector targets the site ttTi4348 on Chr. I.
Use with strain EG6701 at the CGC.
Note - plasmid contains TWO M13F primer sites.
Proper citation: RRID:Addgene_30538 Copy
Species: Homo sapiens
Genetic Insert: CD4-tdGFP
Vector Backbone Description: Backbone Size:10193; Vector Backbone:pAPIC-HIH; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21606367
Comments: Gateway destination vector for cloning any enhancer to drive expression of membrane marker CD4-tdGFP
The depositing laboratory recommends growing bacteria either on LB plates with 80 ug/ml Carbenicillin or in LB liquid media with 60 ug/ml Carbenicillin (a semi-synthetic ampicillin analog)
Proper citation: RRID:Addgene_31221 Copy
Vector Backbone Description: Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24395366
Proper citation: RRID:Addgene_161880 Copy
Vector Backbone Description: Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24395366
Proper citation: RRID:Addgene_161883 Copy
Vector Backbone Description: Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24395366
Proper citation: RRID:Addgene_161887 Copy
Vector Backbone Description: Vector Backbone:pFUGW; Vector Types:Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24395366
Proper citation: RRID:Addgene_161888 Copy
Vector Backbone Description: Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24395366
Proper citation: RRID:Addgene_161878 Copy
Vector Backbone Description: Backbone Size:10000; Vector Backbone:MA1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24388174
Proper citation: RRID:Addgene_161783 Copy
Vector Backbone Description: Backbone Size:10000; Vector Backbone:MA1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24388174
Proper citation: RRID:Addgene_161786 Copy
Vector Backbone Description: Backbone Size:10000; Vector Backbone:MA1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24388174
Proper citation: RRID:Addgene_161785 Copy
Vector Backbone Description: Vector Backbone:pET43.1a; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Proper citation: RRID:Addgene_161890 Copy
Species: Synthetic
Genetic Insert: pSB1A3-BbsI-M86N-T-cat-PPhlF-RiboJ-B32-M86C-SapI
Vector Backbone Description: Backbone Marker:BioBrick; Vector Backbone:pSB1A3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:33850130
Proper citation: RRID:Addgene_161939 Copy
Species: Synthetic
Genetic Insert: pSB1A3-BbsI-M86N-cat-Plux2-B32-M86C-SapI
Vector Backbone Description: Backbone Marker:BioBrick; Vector Backbone:pSB1A3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:33850130
Proper citation: RRID:Addgene_161938 Copy
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:24395366
Proper citation: RRID:Addgene_161895 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
