Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Caenorhabditis elegans
Genetic Insert: U6 promoter::dpy-10 sgRNA with a "flipped and extended" sgRNA backbone
Vector Backbone Description: Backbone Marker:Genscript; Backbone Size:2710; Vector Backbone:pUC57; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26044730
Proper citation: RRID:Addgene_65630 Copy
Species: Caenorhabditis elegans
Genetic Insert: sgRNA for APs12
Vector Backbone Description: Backbone Marker:Goldstein lab Plasmid 47549; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25249454
Comments: From the depositor: Each positive clones had been sequenced for correct insertion of the sgRNA . However the PCR could have created some mutation in the plasmid backbone (containing also the Cas9 gene) and we didnt sequenced the full plasmid, therefore we recommend to use a mix of several positive clones. It is why we provide several clones containing the same sgRNA insert.
Proper citation: RRID:Addgene_65599 Copy
Species: Caenorhabditis elegans
Genetic Insert: NLG-1
Vector Backbone Description: Backbone Marker:C.I. Bargmann and S. MaCarroll ; Backbone Size:3500; Vector Backbone:pSM; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18255029
Comments: Mutation N142S does not affect plasmid function
Proper citation: RRID:Addgene_65828 Copy
Species: Caenorhabditis elegans
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:Not Available; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26712014
Proper citation: RRID:Addgene_68120 Copy
Species: Caenorhabditis elegans
Genetic Insert: CoChR
Vector Backbone Description: Vector Backbone:pUC57-Kan; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26022242
Comments: This construct was produced through de novo gene synthesis.
CoChR amino acid sequence was published in: Klapoetke NC, Murata Y, Kim SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ, Tian Z, Wang J, Xie Y, Yan Z, Zhang Y, Chow BY, Surek B, Melkonian M, Jayaraman V, Constantine-Paton M, Wong GK, and Boyden ES. 2014. Independent optical excitation of distinct neural populations. Nat. Meth. 11, 338-346.
Proper citation: RRID:Addgene_66103 Copy
Species: Caenorhabditis elegans
Genetic Insert: RSF-1
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23103556
Proper citation: RRID:Addgene_66862 Copy
Species: Caenorhabditis elegans
Genetic Insert: Let-60
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23103556
Proper citation: RRID:Addgene_66860 Copy
Species: Caenorhabditis elegans
Genetic Insert: YPET-C1^SEC^3xFlag
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26044593
Comments: IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined.
Proper citation: RRID:Addgene_66824 Copy
Species: Caenorhabditis elegans
Genetic Insert: GFP-C1^SEC^3xFlag
Vector Backbone Description: Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26044593
Comments: IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined.
Sequence note: The full sequence is based on Addgene NGS of our stock. There may be some slight but innocuous inconsistencies with the depositor's GenBank files. One discrepancy affects the sequence of the 3' arm reverse primer (Table P1 and Figure P1) from the associated publication. The first g from the 3' end is missing:[tcacacaggaaacagctatgaccatgttat] -> [tcacacaggaaacagctatgaccatttat]
Proper citation: RRID:Addgene_66823 Copy
Species: Caenorhabditis elegans
Genetic Insert: C.elegans YAP-1
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:PD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23396260
Comments: I performed PCR on C.elegans genome to isolate the genome of YAP-1 which contain 5' UTR and the coding exons and introns. I subcloned the product into PstI/SmaI sites of PD95.75, so that GFP is fused to the last exon. Serine 104 was mutated to alanine.
Proper citation: RRID:Addgene_66857 Copy
Species: Caenorhabditis elegans
Genetic Insert: EGL-44
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23396260
Proper citation: RRID:Addgene_66855 Copy
Species: Caenorhabditis elegans
Genetic Insert: WTS-1
Vector Backbone Description: Backbone Marker:Eastman Kodak Company; Backbone Size:4700; Vector Backbone:pFLAG-CMV-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23396260
Proper citation: RRID:Addgene_66856 Copy
Species: Caenorhabditis elegans
Genetic Insert: CeSmg7_1-395-G80E
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23348841
Comments: ORF extracted from NCBI:NM_068632.4 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147476 Copy
Species: Caenorhabditis elegans
Genetic Insert: CeAIN2_254-400
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23172285
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147407 Copy
Species: Caenorhabditis elegans
Genetic Insert: CeAIN1-W378AW437A
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22402495
Comments: ORF extracted from NCBI:NM_078286.4 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147136 Copy
Species: Caenorhabditis elegans
Genetic Insert: CeALG1
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22402495
Comments: ORF extracted from NCBI: NM_077921.5 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147147 Copy
Species: Caenorhabditis elegans
Genetic Insert: GluCl beta
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12648766
Comments: The lab has created an improved version of this plasmid, which can be found at http://www.addgene.org/47542/ .
Proper citation: RRID:Addgene_15105 Copy
Species: Caenorhabditis elegans
Genetic Insert: GluCl alpha
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12648766
Comments: The lab has created an improved version of this plasmid, which can be found at http://www.addgene.org/47387/ .
Proper citation: RRID:Addgene_15104 Copy
Species: Caenorhabditis elegans
Genetic Insert: Frataxin homologue
Vector Backbone Description: Backbone Size:2676; Vector Backbone:L4440; Vector Types:RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17215485
Proper citation: RRID:Addgene_15401 Copy
Species: Caenorhabditis elegans
Genetic Insert: Frataxin homologue
Vector Backbone Description: Backbone Size:2676; Vector Backbone:L4440; Vector Types:RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17215485
Proper citation: RRID:Addgene_15400 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
