Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: gRNA_hIRF1 promoter #12
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:8083; Vector Backbone:pSIR; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25051498
Comments: gRNA target sequence: CCGGGGGCGCTGGGCTGTCCCGG
Proper citation: RRID:Addgene_61080 Copy
Species: Homo sapiens
Genetic Insert: H1 promoter; gRNA sequences
Vector Backbone Description: Backbone Size:2636; Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, /Cas9 gRNA cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25209046
Comments: As Ampicillin gene and H1 promoter contain BsaI sites, we mutated the sequence of Amp gene (G1601C, not change amino acid), and mutated H1 promoter from GAGACC to GAGGACC to eliminate the BsaI internal site.
Proper citation: RRID:Addgene_61089 Copy
Species: Homo sapiens
Genetic Insert: SENP2M497A catalytic domain
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:7328; Vector Backbone:PET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23955022
Proper citation: RRID:Addgene_61088 Copy
Species: Homo sapiens
Genetic Insert: human DIXDC1
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBabe-Hygro-DEST; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25042806
Proper citation: RRID:Addgene_61213 Copy
Species: Homo sapiens
Genetic Insert: human DIXDC1
Vector Backbone Description: Backbone Size:8410; Vector Backbone:pLenti-CMV/TO-PURO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25042806
Proper citation: RRID:Addgene_61218 Copy
Species: Homo sapiens
Genetic Insert: human DIXDC1
Vector Backbone Description: Backbone Marker:Addgene #17400; Backbone Size:8614; Vector Backbone:pQCXIB; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25042806
Proper citation: RRID:Addgene_61225 Copy
Species: Homo sapiens
Genetic Insert: human DIXDC1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25042806
Proper citation: RRID:Addgene_61223 Copy
Species: Homo sapiens
Genetic Insert: DIXDC1
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pENTR/pTER+; Vector Types:ENTR clone; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25042806
Proper citation: RRID:Addgene_61237 Copy
Species: Homo sapiens
Genetic Insert: shLkb1 (Ms/Hu)
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pENTR/pTER+; Vector Types:ENTR clone; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25042806
Proper citation: RRID:Addgene_61234 Copy
Species: Homo sapiens
Genetic Insert: LKB1
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pENTR/pTER+; Vector Types:ENTR clone; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25042806
Proper citation: RRID:Addgene_61243 Copy
Species: Homo sapiens
Genetic Insert: LKB1
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pLentiX2-PURO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25042806
Proper citation: RRID:Addgene_61242 Copy
Species: Homo sapiens
Genetic Insert: MBNL1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_61277 Copy
Species: Homo sapiens
Genetic Insert: CUG-BP
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_61276 Copy
Species: Homo sapiens
Genetic Insert: NOVA1
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_61275 Copy
Species: Homo sapiens
Genetic Insert: KCC2
Vector Backbone Description: Backbone Size:6900; Vector Backbone:pCITF; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19376067
Proper citation: RRID:Addgene_61404 Copy
Species: Homo sapiens
Genetic Insert: OTUD1
Vector Backbone Description: Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23827681
Proper citation: RRID:Addgene_61405 Copy
Species: Homo sapiens
Genetic Insert: OTUD1
Vector Backbone Description: Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23827681
Comments: Hospenthal MK, Mevissen TET, Komander D. Nature Protoc. 2015 Jan 29;10:349-361. doi:10.1038/nprot.2015.018
Proper citation: RRID:Addgene_61406 Copy
Species: Homo sapiens
Genetic Insert: Inhibitor-3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5800; Vector Backbone:pcDNA5FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25298395
Comments: resistant against siRNA oligomer I3 S2 (CUGCUGTAUUUAUGAGAAA)
Proper citation: RRID:Addgene_61400 Copy
Species: Homo sapiens
Genetic Insert: OTUD2
Vector Backbone Description: Backbone Marker:OPPF-UK; Backbone Size:6299; Vector Backbone:pOPINK; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23827681
Comments: Hospenthal MK, Mevissen TET, Komander D. Nature Protoc. 2015 Jan 29;10:349-361. doi:10.1038/nprot.2015.018
Proper citation: RRID:Addgene_61409 Copy
Species: Homo sapiens
Genetic Insert: S.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300)
Vector Backbone Description: Backbone Marker:Invitrogen; Life Technologies; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25849900
Proper citation: RRID:Addgene_61361 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
