Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 76 showing 1501 ~ 1520 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_48118

    This resource has 1+ mentions.

http://www.addgene.org/48118

Genetic Insert: signal peptide of YngK
Vector Backbone Description: Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20435764

Proper citation: RRID:Addgene_48118 Copy   


  • RRID:Addgene_48185

    This resource has 1+ mentions.

http://www.addgene.org/48185

Species: Mus musculus
Genetic Insert: Capicua
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3783; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23512657

Proper citation: RRID:Addgene_48185 Copy   


  • RRID:Addgene_48189

    This resource has 1+ mentions.

http://www.addgene.org/48189

Species: Homo sapiens
Genetic Insert: Ataxin1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNA1.1/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23512657

Proper citation: RRID:Addgene_48189 Copy   


  • RRID:Addgene_48215

    This resource has 10+ mentions.

http://www.addgene.org/48215

Species: M. jannaschii
Genetic Insert: polyspecific MJ tyrosyl synthetase
Vector Backbone Description: Backbone Marker:Schultz lab; Vector Backbone:pULTRA; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:17061854
Comments: This plasmid was also used in Chatterjee et al Biochemistry. 2013 Feb 27. PMID: 23379331

Proper citation: RRID:Addgene_48215 Copy   


  • RRID:Addgene_48218

    This resource has 1+ mentions.

http://www.addgene.org/48218

Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2799; Vector Backbone:pCR8/GW/TOPO; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48218 Copy   


  • RRID:Addgene_48201

    This resource has 10+ mentions.

http://www.addgene.org/48201

Species: Aequorea victoria green
Genetic Insert: eGFP
Vector Backbone Description: Backbone Marker:Gage lab (Addgene plasmid# 16664); Backbone Size:6764; Vector Backbone:CAG-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16399667

Proper citation: RRID:Addgene_48201 Copy   


  • RRID:Addgene_48143

    This resource has 1+ mentions.

http://www.addgene.org/48143

Genetic Insert: rna polymerase SP6
Vector Backbone Description: Backbone Marker:Gamer et al., 2009; Vector Backbone:pMGBm19; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20596705
Comments: Please note that the V313A mutation in RNAP was present in the original sample and functions as described in the publication.

Proper citation: RRID:Addgene_48143 Copy   


  • RRID:Addgene_48138

    This resource has 1000+ mentions.

http://www.addgene.org/48138

Species: Synthetic
Genetic Insert: hSpCas9
Vector Backbone Description: Vector Backbone:PX458; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24157548
Comments: For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/.

Proper citation: RRID:Addgene_48138 Copy   


  • RRID:Addgene_48131

    This resource has 1+ mentions.

http://www.addgene.org/48131

Genetic Insert: gfp
Vector Backbone Description: Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20596705

Proper citation: RRID:Addgene_48131 Copy   


http://www.addgene.org/48238

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pX335 (Addgene #42335); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979020
Comments: Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48238 Copy   


  • RRID:Addgene_48233

    This resource has 1+ mentions.

http://www.addgene.org/48233

Species: Saccharomyces cerevisiae
Genetic Insert: URA3 3' fragment
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24604451

Proper citation: RRID:Addgene_48233 Copy   


http://www.addgene.org/48226

Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A) fusion with VP160 activation domain followed by 2A-puro
Vector Backbone Description: Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48226 Copy   


  • RRID:Addgene_48227

    This resource has 1+ mentions.

http://www.addgene.org/48227

Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A) fusion with VP160 activation domain followed by 2A-neo
Vector Backbone Description: Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48227 Copy   


  • RRID:Addgene_48345

    This resource has 1+ mentions.

http://www.addgene.org/48345

Species: Synthetic
Genetic Insert: mKate2
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2639; Vector Backbone:pDONRP2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834

Proper citation: RRID:Addgene_48345 Copy   


  • RRID:Addgene_48225

    This resource has 1+ mentions.

http://www.addgene.org/48225

Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A) fusion with VP160 activation domain
Vector Backbone Description: Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48225 Copy   


  • RRID:Addgene_48223

    This resource has 1+ mentions.

http://www.addgene.org/48223

Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A) fusion with VP64 activation domain
Vector Backbone Description: Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48223 Copy   


  • RRID:Addgene_48221

    This resource has 1+ mentions.

http://www.addgene.org/48221

Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A) fusion with VP160 activation domain
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2799; Vector Backbone:pCR8/GW/TOPO; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48221 Copy   


  • RRID:Addgene_48337

    This resource has 1+ mentions.

http://www.addgene.org/48337

Species: Photinus pyralis
Genetic Insert: firely luciferase
Vector Backbone Description: Backbone Marker:Martin P. Vazquez; Backbone Size:6200; Vector Backbone:pTrex; Vector Types:Trypanasoma cruzi expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20644616

Proper citation: RRID:Addgene_48337 Copy   


  • RRID:Addgene_48332

    This resource has 10+ mentions.

http://www.addgene.org/48332

Genetic Insert: TVA receptor mCherry
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24239125

Proper citation: RRID:Addgene_48332 Copy   


  • RRID:Addgene_48331

    This resource has 10+ mentions.

http://www.addgene.org/48331

Genetic Insert: TVA receptor mCherry fusion with the 66T mutation
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24239125

Proper citation: RRID:Addgene_48331 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X