Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pIK208 Resource Report Resource Website 1+ mentions |
RRID:Addgene_65630 | U6 promoter::dpy-10 sgRNA with a "flipped and extended" sgRNA backbone | Caenorhabditis elegans | Ampicillin | PMID:26044730 | Backbone Marker:Genscript; Backbone Size:2710; Vector Backbone:pUC57; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:18:20 | 1 | ||
|
AP54-5 Resource Report Resource Website |
RRID:Addgene_65599 | sgRNA for APs12 | Caenorhabditis elegans | Ampicillin | PMID:25249454 | From the depositor: Each positive clones had been sequenced for correct insertion of the sgRNA . However the PCR could have created some mutation in the plasmid backbone (containing also the Cas9 gene) and we didnt sequenced the full plasmid, therefore we recommend to use a mix of several positive clones. It is why we provide several clones containing the same sgRNA insert. | Backbone Marker:Goldstein lab Plasmid 47549; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:18:20 | 0 | |
|
Pflp-18::NGL-1::spGFP11 Resource Report Resource Website 1+ mentions |
RRID:Addgene_65828 | NLG-1 | Caenorhabditis elegans | Ampicillin | PMID:18255029 | Mutation N142S does not affect plasmid function | Backbone Marker:C.I. Bargmann and S. MaCarroll ; Backbone Size:3500; Vector Backbone:pSM; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | N142S | 2026-08-15 01:18:21 | 2 |
|
Prab-3::NLS::GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_68120 | GFP | Caenorhabditis elegans | Ampicillin | PMID:26712014 | Vector Backbone:Not Available; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:18:44 | 1 | ||
|
dg265_pENTR_CoChRCel Resource Report Resource Website |
RRID:Addgene_66103 | CoChR | Caenorhabditis elegans | Kanamycin | PMID:26022242 | This construct was produced through de novo gene synthesis. CoChR amino acid sequence was published in: Klapoetke NC, Murata Y, Kim SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ, Tian Z, Wang J, Xie Y, Yan Z, Zhang Y, Chow BY, Surek B, Melkonian M, Jayaraman V, Constantine-Paton M, Wong GK, and Boyden ES. 2014. Independent optical excitation of distinct neural populations. Nat. Meth. 11, 338-346. | Vector Backbone:pUC57-Kan; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:18:25 | 0 | |
|
pClneoEGFPC RSF-1 Resource Report Resource Website |
RRID:Addgene_66862 | RSF-1 | Caenorhabditis elegans | Ampicillin | PMID:23103556 | Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S18G, S229T, I403T and F563S mutations in RSF-1 compared to GenBank reference sequence NP_001022361.1 | 2026-08-15 01:18:30 | 0 | |
|
pClneoFH-let60 G12V Resource Report Resource Website 1+ mentions |
RRID:Addgene_66860 | Let-60 | Caenorhabditis elegans | Ampicillin | PMID:23103556 | Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Glycine 12 is mutated to valine | 2026-08-15 01:18:33 | 1 | |
|
pDD283 Resource Report Resource Website 1+ mentions |
RRID:Addgene_66824 | YPET-C1^SEC^3xFlag | Caenorhabditis elegans | Ampicillin | PMID:26044593 | IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined. | Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:18:30 | 3 | |
|
pDD282 Resource Report Resource Website 50+ mentions |
RRID:Addgene_66823 | GFP-C1^SEC^3xFlag | Caenorhabditis elegans | Ampicillin | PMID:26044593 | IMPORTANT NOTE: The repeat regions in this plasmid make it susceptible to recombination. The depositing lab grows the plasmid at 30°C. You may also want to prep and digest multiple single colonies to verify that you have a clone that has not recombined. Sequence note: The full sequence is based on Addgene NGS of our stock. There may be some slight but innocuous inconsistencies with the depositor's GenBank files. One discrepancy affects the sequence of the 3' arm reverse primer (Table P1 and Figure P1) from the associated publication. The first g from the 3' end is missing:[tcacacaggaaacagctatgaccatgttat] -> [tcacacaggaaacagctatgaccatttat] | Backbone Size:2600; Vector Backbone:pUC19 (modified); Vector Types:Worm Expression, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:18:32 | 51 | |
|
pPD95.75-cYAP-1 Resource Report Resource Website |
RRID:Addgene_66857 | C.elegans YAP-1 | Caenorhabditis elegans | Ampicillin | PMID:23396260 | I performed PCR on C.elegans genome to isolate the genome of YAP-1 which contain 5' UTR and the coding exons and introns. I subcloned the product into PstI/SmaI sites of PD95.75, so that GFP is fused to the last exon. Serine 104 was mutated to alanine. | Backbone Marker:Addgene; Vector Backbone:PD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | Serine104 is mutated to alanine | 2026-08-15 01:18:33 | 0 |
|
pClneoMyc'-EGL-44 Resource Report Resource Website |
RRID:Addgene_66855 | EGL-44 | Caenorhabditis elegans | Ampicillin | PMID:23396260 | Backbone Marker:Promega; Vector Backbone:pClneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:18:30 | 0 | ||
|
pFLAG-WTS-1 Resource Report Resource Website |
RRID:Addgene_66856 | WTS-1 | Caenorhabditis elegans | Ampicillin | PMID:23396260 | Backbone Marker:Eastman Kodak Company; Backbone Size:4700; Vector Backbone:pFLAG-CMV-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | E153G and D871G mutations in WTS1 compared to GenBank reference sequence NP_492699.1 | 2026-08-15 01:18:30 | 0 | |
|
pRSFDuetMP-CeSmg7_1-395-G80E_S Resource Report Resource Website |
RRID:Addgene_147476 | CeSmg7_1-395-G80E | Caenorhabditis elegans | Kanamycin | PMID:23348841 | ORF extracted from NCBI:NM_068632.4 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:07:07 | 0 | |
|
pAc5.1B-lambdaN-HA-CeAIN2_254-400-V5His6_R Resource Report Resource Website |
RRID:Addgene_147407 | CeAIN2_254-400 | Caenorhabditis elegans | Ampicillin | PMID:23172285 | Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | Deletion of 2 AA (SD) at position 378-379 compared to the sequence given by NCBI: AF000196.1 | 2026-08-15 01:07:06 | 0 |
|
pAc5.1B-lambdaN-HA-CeAIN1-W378AW437A_O Resource Report Resource Website |
RRID:Addgene_147136 | CeAIN1-W378AW437A | Caenorhabditis elegans | Ampicillin | PMID:22402495 | ORF extracted from NCBI:NM_078286.4 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:07 | 0 | |
|
pAc5.1B-lambdaN-HA-CeALG1_O Resource Report Resource Website |
RRID:Addgene_147147 | CeALG1 | Caenorhabditis elegans | Ampicillin | PMID:22402495 | ORF extracted from NCBI: NM_077921.5 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid. | Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:06 | 0 | |
|
optGluCl beta Y182F ECFP Resource Report Resource Website |
RRID:Addgene_15105 | GluCl beta | Caenorhabditis elegans | Ampicillin | PMID:12648766 | The lab has created an improved version of this plasmid, which can be found at http://www.addgene.org/47542/ . | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Codon optimized cDNA, Y182F | 2026-08-15 01:07:19 | 0 |
|
optGluCl alpha EYFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_15104 | GluCl alpha | Caenorhabditis elegans | Ampicillin | PMID:12648766 | The lab has created an improved version of this plasmid, which can be found at http://www.addgene.org/47387/ . | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Codon optimized cDNA | 2026-08-15 01:07:19 | 4 |
|
frh-1-C Resource Report Resource Website |
RRID:Addgene_15401 | Frataxin homologue | Caenorhabditis elegans | Ampicillin | PMID:17215485 | Backbone Size:2676; Vector Backbone:L4440; Vector Types:RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:45 | 0 | ||
|
frh-1-B Resource Report Resource Website 1+ mentions |
RRID:Addgene_15400 | Frataxin homologue | Caenorhabditis elegans | Ampicillin | PMID:17215485 | Backbone Size:2676; Vector Backbone:L4440; Vector Types:RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:07:44 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
