Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 77 showing 1521 ~ 1540 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/48323

Vector Backbone Description: Backbone Size:3566; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a Spec resistance. To clone into this vector, add LICv2 fusion tags to the 5' end of your PCR primers. LICv2 Forward - 5'TTTAAGAAGGAGATATAGATC3' LICv2 Reverse - 5'TTATGGAGTTGGGATCTTATTA3' Linearize the plasmid with EcoRV and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression. 13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48323 Copy   


http://www.addgene.org/48329

Vector Backbone Description: Backbone Size:3939; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-Sumo fusion tag on the N-terminus and a Spec resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression.13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48329 Copy   


http://www.addgene.org/48328

Vector Backbone Description: Backbone Size:3630; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable StrepII fusion tag on the N-terminus and a Spec resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression. 13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48328 Copy   


http://www.addgene.org/48287

Vector Backbone Description: Backbone Size:5497; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-msfGFP fusion tag on the N-terminus. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48287 Copy   


http://www.addgene.org/48313

Vector Backbone Description: Backbone Size:3371; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.It has a TEV cleavable His6 Sumo tag on the N-terminus and Amp resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The Series-14 plasmids were designed to overcome the unpredictable expression patterns of genes from a polycistronic message. As mentioned in the Series-2 and Series-9 polycistronic sections, often genes that express well from a single gene mRNA do not express at the same level when placed in a polycistronic message next to other genes. This effect is likely due to mRNA structure interfering with access to the ribosome binding site. When we first made our polypromoter plasmids we found that we could clone multiple genes together in the Xl1-Blue cells so that each possess a T7 promoter, followed by a Lac operator, followed by a ribosome binding site, followed by your open reading frame (T7-LacO-RBS-yORF). However, these multi-gene polypromoter plasmids were unable to be transformed into an expression strain such as BL-21 or Rosetta2. We then figured out that we needed a RecAexpression strain (like Rosetta-Blues) to successfully propagate our polypromoter plasmids. Although Rosetta-Blue cells propagated our plasmids, expression was not so great and we didn't want to rely on a specialized strain to perform our expression. Finally, we figured out that it was the LacO that follows the T7 promoter that was causing plasmid instability in our polypromoter system. Removal of the LacO allowed us to express our polypromoter plasmids in Rosetta2 cells and we have had much success with these plasmids since. Much like our Series- 2 plasmids, the Series-14 plasmids are going to give a substantial amount of leaky expression. However, even with this shortcoming, we have found Series-14 to be a valuable resource for expressing multi-protein complexes. Cloning into the Series-14 plasmids and subsequent biobrick subcloning is performed exactly as described for the Series-9 plasmids. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48313 Copy   


http://www.addgene.org/48318

Vector Backbone Description: Backbone Size:3612; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.It has a TEV cleavable His6-StrepII fusion tag on the N-terminus and a Kan resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression. 13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48318 Copy   


http://www.addgene.org/48319

Vector Backbone Description: Backbone Size:3576; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable StrepII fusion tag on the N-terminus and a Kan resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression. 13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48319 Copy   


http://www.addgene.org/48311

Vector Backbone Description: Backbone Size:4151; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable MBP tag on the N-terminus and Amp resistance. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The Series-14 plasmids were designed to overcome the unpredictable expression patterns of genes from a polycistronic message. As mentioned in the Series-2 and Series-9 polycistronic sections, often genes that express well from a single gene mRNA do not express at the same level when placed in a polycistronic message next to other genes. This effect is likely due to mRNA structure interfering with access to the ribosome binding site. When we first made our polypromoter plasmids we found that we could clone multiple genes together in the Xl1-Blue cells so that each possess a T7 promoter, followed by a Lac operator, followed by a ribosome binding site, followed by your open reading frame (T7-LacO-RBS-yORF). However, these multi-gene polypromoter plasmids were unable to be transformed into an expression strain such as BL-21 or Rosetta2. We then figured out that we needed a RecAexpression strain (like Rosetta-Blues) to successfully propagate our polypromoter plasmids. Although Rosetta-Blue cells propagated our plasmids, expression was not so great and we didn't want to rely on a specialized strain to perform our expression. Finally, we figured out that it was the LacO that follows the T7 promoter that was causing plasmid instability in our polypromoter system. Removal of the LacO allowed us to express our polypromoter plasmids in Rosetta2 cells and we have had much success with these plasmids since. Much like our Series- 2 plasmids, the Series-14 plasmids are going to give a substantial amount of leaky expression. However, even with this shortcoming, we have found Series-14 to be a valuable resource for expressing multi-protein complexes. Cloning into the Series-14 plasmids and subsequent biobrick subcloning is performed exactly as described for the Series-9 plasmids. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48311 Copy   


http://www.addgene.org/48304

Vector Backbone Description: Backbone Size:8937; Vector Backbone:pRS426; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function. This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector has a TEV cleavable His6 tag on the N-terminus and can complement Ura auxotrophy. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG) LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-).For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48304 Copy   


http://www.addgene.org/48305

Vector Backbone Description: Backbone Size:10092; Vector Backbone:pRS426; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function. This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector has a TEV cleavable His6-MBP tag on the N-terminus and can complement Ura auxotrophy. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG) LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-). For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48305 Copy   


  • RRID:Addgene_48252

    This resource has 1+ mentions.

http://www.addgene.org/48252

Species: Synthetic
Genetic Insert: HYPER-RED-C199S
Vector Backbone Description: Backbone Size:3975; Vector Backbone:pC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25330925

Proper citation: RRID:Addgene_48252 Copy   


http://www.addgene.org/48240

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pX335 (Addgene #42335); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979020
Comments: Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48240 Copy   


  • RRID:Addgene_48244

    This resource has 1+ mentions.

http://www.addgene.org/48244

Species: Escherichia coli CFT073
Genetic Insert: ClbP
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5370; Vector Backbone:pET29b-(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23406518

Proper citation: RRID:Addgene_48244 Copy   


  • RRID:Addgene_48410

    This resource has 1+ mentions.

http://www.addgene.org/48410

Species: Synthetic
Genetic Insert: RVD sequence: NI NN NN NN
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48410 Copy   


  • RRID:Addgene_48638

    This resource has 1+ mentions.

http://www.addgene.org/48638

Species: Homo sapiens
Genetic Insert: DDB1
Vector Backbone Description: Backbone Marker:Pharmagen; Vector Backbone:pAcGHLT-B; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16413485

Proper citation: RRID:Addgene_48638 Copy   


  • RRID:Addgene_48637

    This resource has 1+ mentions.

http://www.addgene.org/48637

Vector Backbone Description: Backbone Size:5768; Vector Backbone:pCS2; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23667577

Proper citation: RRID:Addgene_48637 Copy   


  • RRID:Addgene_48636

    This resource has 1+ mentions.

http://www.addgene.org/48636

Vector Backbone Description: Backbone Size:5798; Vector Backbone:pCS2; Vector Types:TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23667577

Proper citation: RRID:Addgene_48636 Copy   


  • RRID:Addgene_48659

    This resource has 1+ mentions.

http://www.addgene.org/48659

Species: S. thermophilus #1
Genetic Insert: Cas9, nuclease-null
Vector Backbone Description: Vector Backbone:cloDF13-aadA; Vector Types:CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:24076762

Proper citation: RRID:Addgene_48659 Copy   


  • RRID:Addgene_48645

    This resource has 10+ mentions.

http://www.addgene.org/48645

Species: S. pyogenes
Genetic Insert: Cas9
Vector Backbone Description: Vector Backbone:cloDF13-aadA; Vector Types:CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:24076762

Proper citation: RRID:Addgene_48645 Copy   


  • RRID:Addgene_48754

    This resource has 1+ mentions.

http://www.addgene.org/48754

Vector Backbone Description: Vector Backbone:Bluescript; Vector Types:Mammalian Expression, PiggyBac; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23582324
Comments: Plasmid map is theoretical and may not represent actual sequence. The presence of important plasmid features have been verified by sequencing.

Proper citation: RRID:Addgene_48754 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X