Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: L3S2P00 Terminator
Vector Backbone Description: Backbone Size:5047; Vector Backbone:pGR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23727987
Proper citation: RRID:Addgene_46005 Copy
Vector Backbone Description: Backbone Marker:http://partsregistry.org/partsdb/get_part.cgi?part=pSB1A10; Backbone Size:5191; Vector Backbone:pSB1A10; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23727987
Comments: This is a reporter plasmid for measuring terminator strength by inserting terminator of interest between the GFP and RFP, expression driven by a single PBAD promoter inducible by arabinose.
Proper citation: RRID:Addgene_46002 Copy
Genetic Insert: U6-BbsI-chiRNA
Vector Backbone Description: Backbone Marker:Agilent; Backbone Size:2958; Vector Backbone:pBS-SK(+); Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23709638
Comments: For more information on FlyCRISPR plasmids please refer to: https://www.addgene.org/browse/article/6834/.
Plasmid 51019: pDsRed-attP (www.addgene.org/51019) can be for generating dsDNA donors for homology-directed repair to replace genes or other genomic sequence with an attP docking site.
Please note the F1 ori is in the (+) orientation, rather than the (-) orientation shown in the assembled full sequence.
Proper citation: RRID:Addgene_45946 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5336; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23166051
Comments: Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function.
Proper citation: RRID:Addgene_46059 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4734; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23166051
Comments: Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function.
Proper citation: RRID:Addgene_46058 Copy
Species: Rattus norvegicus
Genetic Insert: Jag1
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pT3-EF1a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23419361
Comments: This plasmid is in the pT3-EF1a vector which contains loxP sites flanking the inverted repeats of SB (sleeping beauty) sequence. Therefore this plasmid cannot not used with Cre for in vivo studies.
Proper citation: RRID:Addgene_46051 Copy
Species: Synthetic
Genetic Insert: klp-12 targeting sgRNA
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pUC57; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817069
Comments: gRNA target sequence GATCCACAAGTTACAATTGG
Proper citation: RRID:Addgene_46170 Copy
Species: Gallus gallus
Genetic Insert: Vcl
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15195105
Proper citation: RRID:Addgene_46171 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5205; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23166051
Comments: Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function.
Proper citation: RRID:Addgene_46055 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4880; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23166051
Comments: Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function.
Proper citation: RRID:Addgene_46056 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5468; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23166051
Comments: Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function.
Proper citation: RRID:Addgene_46053 Copy
Species: Synthetic
Genetic Insert: unc-119 targeting sgRNA
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817069
Comments: gRNA target sequence GAATTTTCTGAAATTAAAGA
Proper citation: RRID:Addgene_46169 Copy
Species: Synthetic
Genetic Insert: codon optimized Cas9_SV40 NLS with intron
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817069
Comments: Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_46168 Copy
Vector Backbone Description: Backbone Size:9909; Vector Backbone:pUASp; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27694947
Proper citation: RRID:Addgene_46162 Copy
Species: Mus musculus
Genetic Insert: mCD8mCherry
Vector Backbone Description: Backbone Size:9929; Vector Backbone:pQUASp; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_46164 Copy
Vector Backbone Description: Backbone Marker:Gerry Rubin; Backbone Size:8151; Vector Backbone:pJFRC-7; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817068
Proper citation: RRID:Addgene_46145 Copy
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:stratagene; Vector Backbone:pBluescript II KS+; Vector Types:Cre/Lox, mutagenic gene trap for zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22908272
Comments: mCherry is in the "+2" reading frame starting from the exon.
This is a Tol2-based FlExTrap vector. It consists of a highly mutagenic gene trap contained within the FlEx cassette that can be stably inverted by both Cre and Flp recombinases. FRT/F3 and loxP/lox5171 are incompatible recombination sites used for the Flp and Cre recombinases, respectively, to stably invert the cassette. The reporter gene, mCherry, has its own initiation codon.
Proper citation: RRID:Addgene_46140 Copy
Genetic Insert: EGFP/mCherry
Vector Backbone Description: Backbone Marker:stratagene; Vector Backbone:pBluescript II KS+; Vector Types:Cre/Lox, Tol2 zebrafish transgenic expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19415631
Comments: This plasmid can be used to make a transgene that expresses EGFP but can be switched to express mCherry if inverted.
This reporter is controlled by a 2.3 kb regulatory sequence consisting of 0.2 kb Xenopus EF1alpha enhancer and 2.1 kb zebrafish
beta-actin 2 sequence including the 1.5 kb enhancer/promoter sequence, the 1st exon (86 bp) and part of the 1st intron (490 bp). To generate a complete intron, the splice acceptor from the rabbit beta-globin gene was placed upstream of the EGFP reporter and a synthetic splice acceptor was placed upstream of the mCherry reporter. The synthetic splice acceptor contains the zebrafish consensus sequence along with intronic and exonic splice enhancers.
There are some discrepancies between Addgene's and the depositor's sequence--these do not affect plasmid function.
Proper citation: RRID:Addgene_46144 Copy
Species: Synthetic
Genetic Insert: QF#7
Vector Backbone Description: Backbone Size:5176; Vector Backbone:pPTGAL4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46136 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GAL80
Vector Backbone Description: Backbone Size:8938; Vector Backbone:pQUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46137 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.