Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
TAL3191 Resource Report Resource Website |
RRID:Addgene_41365 | ZebrafishCommunity-tes-Right | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TTCCCAACTTTCTTGCTC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:45 | 0 | |
|
TAL3190 Resource Report Resource Website |
RRID:Addgene_41364 | ZebrafishCommunity-tes-Left | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TTGAGGACCATGACGTGC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:45 | 0 | |
|
TAL3189 Resource Report Resource Website |
RRID:Addgene_41363 | ZebrafishCommunity-tac3a-Right | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TCATAATCTGTCACTTAC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:45 | 0 | |
|
TAL3188 Resource Report Resource Website |
RRID:Addgene_41362 | ZebrafishCommunity-tac3a-Left | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TCAGCAGTCAGAGTCTCA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:45 | 0 | |
|
GoldyTALEN-ppp1cab TAL2 Resource Report Resource Website |
RRID:Addgene_41836 | protein phosphatase 1, catalytic subunit, alpha isoform b | Danio rerio | Ampicillin | PMID:23000899 | The ppp1cab TALEN recognition sequences are: left TALEN 5′-CCACCAGAGAGTAACT-3′ and right TALEN 5′-GCCTCTGTCAACATAGT-3′. Between the two binding sites is a 15-bp spacer containing a BsII site (ACCTATTTCTGGGAG). See Addgene plasmid# 41835 and the associated publication for more information. | Backbone Marker:Dan Carlson (Addgene plasmid# 38142); Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:cloning vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:48 | 0 | |
|
GoldyTALEN-ppp1cab TAL1 Resource Report Resource Website |
RRID:Addgene_41835 | protein phosphatase 1, catalytic subunit, alpha isoform b | Danio rerio | Ampicillin | PMID:23000899 | The ppp1cab TALEN recognition sequences are: left TALEN 5′-CCACCAGAGAGTAACT-3′ and right TALEN 5′-GCCTCTGTCAACATAGT-3′. Between the two binding sites is a 15-bp spacer containing a BsII site (ACCTATTTCTGGGAG). See Addgene plasmid# 41836 and the associated publication for more information. | Backbone Marker:Dan Carlson (Addgene plasmid# 38142); Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:cloning vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:48 | 0 | |
|
GoldyTALEN-cdh5 TAL2 Resource Report Resource Website |
RRID:Addgene_41834 | cadherin 5 | Danio rerio | Ampicillin | PMID:23000899 | The cdh5 TALEN recognition sequences are: left TALEN 5′-CTCCTCAACATACATACT-3′ and right TALEN 5′-ACAAATGATTCATCTT-3′. Between the two binding sites is a 16-bp spacer containing a HincII site (GGAGAGTTAGTTGACA). See Addgene plasmid# 41833 and the associated publication for more information. | Backbone Marker:Dan Carlson (Addgene plasmid# 38142); Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:cloning vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:48 | 0 | |
|
GoldyTALEN-moesina TAL2 Resource Report Resource Website |
RRID:Addgene_41832 | moesin a | Danio rerio | Ampicillin | PMID:23000899 | The moesina TALEN recognition sequences are: left TALEN 5′-ACCCAGAAGACGTTT-3′ and right TALEN 5′-CTTTGAGTGGCCTCCT-3′. Between the two binding sites is a 15-bp spacer containing an XmnI site (CTGAGGAACTGATTC). See Addgene plasmid# 41831 and the associated publication for more information. | Backbone Marker:Dan Carlson (Addgene plasmid# 38142); Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:cloning vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:48 | 0 | |
|
GoldyTALEN-moesina TAL1 Resource Report Resource Website |
RRID:Addgene_41831 | moesin a | Danio rerio | Ampicillin | PMID:23000899 | The moesina TALEN recognition sequences are: left TALEN 5′-ACCCAGAAGACGTTT-3′ and right TALEN 5′-CTTTGAGTGGCCTCCT-3′. Between the two binding sites is a 15-bp spacer containing an XmnI site (CTGAGGAACTGATTC). See Addgene plasmid# 41832 and the associated publication for more information. | Backbone Marker:Dan Carlson (Addgene plasmid# 38142); Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:cloning vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:48 | 0 | |
|
Zebrafish-gRNA-0009 Resource Report Resource Website |
RRID:Addgene_42249 | gRNA-tph1a | Danio rerio | Kanamycin | PMID:23360964 | Target site: GGGAAAACACAACCGCAGCC Guide RNA sequence: TAATACGACTCACTATAGGGAAAACACAACCGCAGCCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA | Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:52 | 0 | |
|
Zebrafish-gRNA-0001 Resource Report Resource Website |
RRID:Addgene_42241 | gRNA-apoea | Danio rerio | Kanamycin | PMID:23360964 | Target site: GGATGAGCCAAGAAGCCGCT Guide RNA sequence: TAATACGACTCACTATAGGATGAGCCAAGAAGCCGCTGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA | Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:51 | 0 | |
|
Zebrafish-gRNA-0004 Resource Report Resource Website |
RRID:Addgene_42244 | gRNA-fh site #2 | Danio rerio | Kanamycin | PMID:23360964 | Target site: GGAGCGAGCGGAGCGGTACA Guide RNA sequence: TAATACGACTCACTATAGGAGCGAGCGGAGCGGTACAGTTTTAGAGCTAGAAATAGCAAGT TAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA | Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:51 | 0 | |
|
Zebrafish-gRNA-0005 Resource Report Resource Website |
RRID:Addgene_42245 | gRNA-gsk3b | Danio rerio | Kanamycin | PMID:23360964 | Target site: GGGACCTGACCGGCCGCAGG Guide RNA sequence: TAATACGACTCACTATAGGGACCTGACCGGCCGCAGGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA | Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:52 | 0 | |
|
Zebrafish-gRNA-0007 Resource Report Resource Website |
RRID:Addgene_42247 | gRNA-th1 | Danio rerio | Kanamycin | PMID:23360964 | Target site: GGATGCGCGTAAGGAGCGCG Guide RNA sequence: TAATACGACTCACTATAGGATGCGCGTAAGGAGCGCGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA | Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:51 | 0 | |
|
Tol2-ftyrp>TRAP Resource Report Resource Website |
RRID:Addgene_42299 | EGFP-Rpl10a | Danio rerio | Ampicillin | PMID:23281262 | Backbone Size:6140; Vector Backbone:pT2KXIG; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:52 | 0 | ||
|
RCIscript-GoldyTALEN-ponzr1L Resource Report Resource Website |
RRID:Addgene_42654 | ponzr1 left pTAL scaffold | Danio rerio | Ampicillin | PMID:23000899 | Backbone Marker:Addgene plasmid 38142; Backbone Size:4651; Vector Backbone:RCIscript-GoldyTALEN; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:55 | 0 | ||
|
TAL3236 Resource Report Resource Website |
RRID:Addgene_42699 | ZebrafishCommunity-dbx1b-left | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TCCCGTGCAAGGAATGAA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:56 | 0 | |
|
TAL3230 Resource Report Resource Website |
RRID:Addgene_42693 | ZebrafishCommunity-Complement Factor H-left | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TGATTACATGTGAACCTC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:56 | 0 | |
|
TAL3227 Resource Report Resource Website |
RRID:Addgene_42690 | ZebrafishCommunity-CIT1-right | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TCGACTGCGGACAGATCT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:56 | 0 | |
|
TAL3217 Resource Report Resource Website |
RRID:Addgene_42680 | ZebrafishCommunity-atg12-right | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TCAAAAAGCACACCAACT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:55 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
