Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 79 showing 1561 ~ 1580 out of 69,553 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_46957

    This resource has 10+ mentions.

http://www.addgene.org/46957

Species: Homo sapiens
Genetic Insert: Ku70
Vector Backbone Description: Backbone Size:4766; Vector Backbone:pEGFP-C1-FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23897892

Proper citation: RRID:Addgene_46957 Copy   


  • RRID:Addgene_46950

    This resource has 1+ mentions.

http://www.addgene.org/46950

Species: Homo sapiens
Genetic Insert: HPV52L1+L2
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18360909

Proper citation: RRID:Addgene_46950 Copy   


  • RRID:Addgene_46945

http://www.addgene.org/46945

Species: Homo sapiens
Genetic Insert: Ap1g1-FKBP
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pIRESneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20159602

Proper citation: RRID:Addgene_46945 Copy   


  • RRID:Addgene_46944

    This resource has 1+ mentions.

http://www.addgene.org/46944

Species: Homo sapiens
Genetic Insert: Ap2a2-FKBP
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pIRESneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20159602

Proper citation: RRID:Addgene_46944 Copy   


  • RRID:Addgene_46942

    This resource has 1+ mentions.

http://www.addgene.org/46942

Species: Homo sapiens
Genetic Insert: Mitotrap
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEYFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20159602

Proper citation: RRID:Addgene_46942 Copy   


  • RRID:Addgene_46893

http://www.addgene.org/46893

Species: Homo sapiens
Genetic Insert: SH3BP4 W92A
Vector Backbone Description: Backbone Marker:clonetch; Vector Backbone:pRK5-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22575674
Comments: Mutagenesis was performed using a site-directed mutagenesis kit (Stratagene) and the following primer: cacatctggcggtgaggcgtggtacgcacacaac

Proper citation: RRID:Addgene_46893 Copy   


  • RRID:Addgene_46932

http://www.addgene.org/46932

Species: Homo sapiens
Genetic Insert: FJX1
Vector Backbone Description: Backbone Size:12800; Vector Backbone:LZRS-MS-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_46932 Copy   


  • RRID:Addgene_46930

http://www.addgene.org/46930

Species: Homo sapiens
Genetic Insert: FJX1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5015; Vector Backbone:pcDNA3.1/Zeo(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_46930 Copy   


  • RRID:Addgene_46931

http://www.addgene.org/46931

Species: Homo sapiens
Genetic Insert: FJX1
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag 4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_46931 Copy   


  • RRID:Addgene_46926

    This resource has 10+ mentions.

http://www.addgene.org/46926

Species: Homo sapiens
Genetic Insert: 5X HRE of VEGF
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pEF/myc/cyto; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11774035
Comments: The 35-bp human VEGF HRE sequence is: CCACAGTGCATACGTGGGCTCCAACAGGTCCTCTT The d2EGFP fragment was amplified from a Clontech (Palo Alto, CA) vector and encodes a destabilized red- shifted variant of wild-type GFP with an excitation maximum of 488 nm, an emission maximum of 507 nm, and a half-life of approximately 2 hours.

Proper citation: RRID:Addgene_46926 Copy   


  • RRID:Addgene_46924

    This resource has 1+ mentions.

http://www.addgene.org/46924

Species: Homo sapiens
Genetic Insert: Park2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4698; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23319602

Proper citation: RRID:Addgene_46924 Copy   


  • RRID:Addgene_46929

    This resource has 1+ mentions.

http://www.addgene.org/46929

Species: Homo sapiens
Genetic Insert: FJX1
Vector Backbone Description: Backbone Size:12800; Vector Backbone:LZRS-MS-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_46929 Copy   


  • RRID:Addgene_46928

http://www.addgene.org/46928

Species: Homo sapiens
Genetic Insert: FJX1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5200; Vector Backbone:pIRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: A 5' EcoRI site and 3' myc tag were added to the FJX1 cDNA by PCR. The fragment was blunt end ligated into an EcoRV site on pIRES-EGFP so there is an additional EcoRI site at 5' end of FJX1.

Proper citation: RRID:Addgene_46928 Copy   


  • RRID:Addgene_46885

    This resource has 1+ mentions.

http://www.addgene.org/46885

Species: Homo sapiens
Genetic Insert: Uracil-N-glycosylase WT
Vector Backbone Description: Backbone Marker:Homemade; Backbone Size:6686; Vector Backbone:pMA2780; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23721969

Proper citation: RRID:Addgene_46885 Copy   


  • RRID:Addgene_46913

    This resource has 1+ mentions.

http://www.addgene.org/46913

Species: Homo sapiens
Genetic Insert: dCas9-p65AD-BFP fusion
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:MSCV-puro; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981

Proper citation: RRID:Addgene_46913 Copy   


  • RRID:Addgene_46918

http://www.addgene.org/46918

Species: Homo sapiens
Genetic Insert: sgCD71 -2
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23849981
Comments: gRNA target sequence GGACGCGCTAGTGTGAGTGC

Proper citation: RRID:Addgene_46918 Copy   


  • RRID:Addgene_46909

    This resource has 1+ mentions.

http://www.addgene.org/46909

Species: Homo sapiens
Genetic Insert: Tau E14 P301L
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21172610
Comments: WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14.

Proper citation: RRID:Addgene_46909 Copy   


  • RRID:Addgene_46907

    This resource has 1+ mentions.

http://www.addgene.org/46907

Species: Homo sapiens
Genetic Insert: Tau E14
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21172610
Comments: WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14.

Proper citation: RRID:Addgene_46907 Copy   


  • RRID:Addgene_46906

    This resource has 1+ mentions.

http://www.addgene.org/46906

Species: Homo sapiens
Genetic Insert: Tau AP P301L
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21172610
Comments: WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14.

Proper citation: RRID:Addgene_46906 Copy   


  • RRID:Addgene_46987

    This resource has 1+ mentions.

http://www.addgene.org/46987

Species: Homo sapiens
Genetic Insert: Triple MBT domain from human L3MBTL1
Vector Backbone Description: Backbone Marker:GE Healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23583077
Comments: Original description of the plasmid in West et al. J Biol Chem. 2010 Nov 26;285(48):37725-32.

Proper citation: RRID:Addgene_46987 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X