Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pEGFP-C1-FLAG-Ku70 Resource Report Resource Website 10+ mentions |
RRID:Addgene_46957 | Ku70 | Homo sapiens | Kanamycin | PMID:23897892 | Backbone Size:4766; Vector Backbone:pEGFP-C1-FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:36 | 13 | ||
|
p52sheLL Resource Report Resource Website 1+ mentions |
RRID:Addgene_46950 | HPV52L1+L2 | Homo sapiens | Ampicillin | PMID:18360909 | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 2 | ||
|
pIRES-Ap1g1-FKBP Resource Report Resource Website |
RRID:Addgene_46945 | Ap1g1-FKBP | Homo sapiens | Ampicillin | PMID:20159602 | Backbone Marker:Clontech; Vector Backbone:pIRESneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:37 | 0 | ||
|
pIRES-Ap2a2-FKBP Resource Report Resource Website 1+ mentions |
RRID:Addgene_46944 | Ap2a2-FKBP | Homo sapiens | Ampicillin | PMID:20159602 | Backbone Marker:Clontech; Vector Backbone:pIRESneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 1 | ||
|
pEYFP-Mitotrap Resource Report Resource Website 1+ mentions |
RRID:Addgene_46942 | Mitotrap | Homo sapiens | Kanamycin | PMID:20159602 | Backbone Marker:Clontech; Vector Backbone:pEYFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:36 | 4 | ||
|
pRK5-HA-SH3BP4 W92A Resource Report Resource Website |
RRID:Addgene_46893 | SH3BP4 W92A | Homo sapiens | Ampicillin | PMID:22575674 | Mutagenesis was performed using a site-directed mutagenesis kit (Stratagene) and the following primer: cacatctggcggtgaggcgtggtacgcacacaac | Backbone Marker:clonetch; Vector Backbone:pRK5-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | W92A (mutated SH3 domain) | 2026-08-15 01:15:36 | 0 |
|
LZRSMS-GFP-hFJX1-Myc Resource Report Resource Website |
RRID:Addgene_46932 | FJX1 | Homo sapiens | Ampicillin | Backbone Size:12800; Vector Backbone:LZRS-MS-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 0 | |||
|
pcDNA-zeo-hFJX1-myc Resource Report Resource Website |
RRID:Addgene_46930 | FJX1 | Homo sapiens | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:5015; Vector Backbone:pcDNA3.1/Zeo(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:37 | 0 | |||
|
pCMV4a-hFJX1-Flag Resource Report Resource Website |
RRID:Addgene_46931 | FJX1 | Homo sapiens | Kanamycin | Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag 4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:15:36 | 0 | |||
|
5HRE/GFP Resource Report Resource Website 10+ mentions |
RRID:Addgene_46926 | 5X HRE of VEGF | Homo sapiens | Ampicillin | PMID:11774035 | The 35-bp human VEGF HRE sequence is: CCACAGTGCATACGTGGGCTCCAACAGGTCCTCTT The d2EGFP fragment was amplified from a Clontech (Palo Alto, CA) vector and encodes a destabilized red- shifted variant of wild-type GFP with an excitation maximum of 488 nm, an emission maximum of 507 nm, and a half-life of approximately 2 hours. | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pEF/myc/cyto; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | five copies of a 35-bp fragment from the hypoxia-responsive element (HRE) of the human VEGF gene and a human cytomegalovirus minimal promoter | 2026-08-15 01:15:37 | 24 |
|
YFP-Parkin C431N Resource Report Resource Website 1+ mentions |
RRID:Addgene_46924 | Park2 | Homo sapiens | Kanamycin | PMID:23319602 | Backbone Marker:Clontech; Backbone Size:4698; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | changed cysteine 431 to asparagine | 2026-08-15 01:15:36 | 2 | |
|
LZRSMS-GFP-hFJX1-Flag Resource Report Resource Website 1+ mentions |
RRID:Addgene_46929 | FJX1 | Homo sapiens | Ampicillin | Backbone Size:12800; Vector Backbone:LZRS-MS-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 1 | |||
|
pIRES-GFP-hFJX1-myc Resource Report Resource Website |
RRID:Addgene_46928 | FJX1 | Homo sapiens | Ampicillin | A 5' EcoRI site and 3' myc tag were added to the FJX1 cDNA by PCR. The fragment was blunt end ligated into an EcoRV site on pIRES-EGFP so there is an additional EcoRI site at 5' end of FJX1. | Backbone Marker:Clontech; Backbone Size:5200; Vector Backbone:pIRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 0 | ||
|
pMA3288 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46885 | Uracil-N-glycosylase WT | Homo sapiens | Ampicillin | PMID:23721969 | Backbone Marker:Homemade; Backbone Size:6686; Vector Backbone:pMA2780; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 1 | ||
|
pMSCV-LTR-dCas9-p65AD-BFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_46913 | dCas9-p65AD-BFP fusion | Homo sapiens | Ampicillin | PMID:23849981 | Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:MSCV-puro; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:37 | 2 | ||
|
pU6-sgCD71-2 Resource Report Resource Website |
RRID:Addgene_46918 | sgCD71 -2 | Homo sapiens | Ampicillin | PMID:23849981 | gRNA target sequence GGACGCGCTAGTGTGAGTGC | Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:36 | 0 | |
|
pRK5-EGFP-Tau E14 P301L Resource Report Resource Website 1+ mentions |
RRID:Addgene_46909 | Tau E14 P301L | Homo sapiens | Ampicillin | PMID:21172610 | WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14. | Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | P301L AND all 14 S/P or T/P amino acid residues (T111, T153, T175, T181, S199, S202, T205, T212, T217, T231, S235, S396, S404, and S422; numbering based on the longest 441-amino acid brain isoform of htau) changed to glutamate | 2026-08-15 01:15:36 | 2 |
|
pRK5-EGFP-Tau E14 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46907 | Tau E14 | Homo sapiens | Ampicillin | PMID:21172610 | WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14. | Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | all 14 S/P or T/P amino acid residues (T111, T153, T175, T181, S199, S202, T205, T212, T217, T231, S235, S396, S404, and S422; numbering based on the longest 441-amino acid brain isoform of htau) to glutamate | 2026-08-15 01:15:37 | 7 |
|
pRK5-EGFP-Tau AP P301L Resource Report Resource Website 1+ mentions |
RRID:Addgene_46906 | Tau AP P301L | Homo sapiens | Ampicillin | PMID:21172610 | WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14. | Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | P301L AND all 14 S/P or T/P amino acid residues (T111, T153, T175, T181, S199, S202, T205, T212, T217, T231, S235, S396, S404, and S422; numbering based on the longest 441-amino acid brain isoform of htau) changed to alanine | 2026-08-15 01:15:36 | 1 |
|
pGEX6P1-3xMBT Resource Report Resource Website 1+ mentions |
RRID:Addgene_46987 | Triple MBT domain from human L3MBTL1 | Homo sapiens | Ampicillin | PMID:23583077 | Original description of the plasmid in West et al. J Biol Chem. 2010 Nov 26;285(48):37725-32. | Backbone Marker:GE Healthcare; Backbone Size:4984; Vector Backbone:pGEX-6P-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains amino acids 190–530 of accession NP_056293.4 | 2026-08-15 01:15:37 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
