Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: CloverGFP-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127
Proper citation: RRID:Addgene_50642 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yomWasabi-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127
Proper citation: RRID:Addgene_50643 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yomWasabi-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127
Proper citation: RRID:Addgene_50649 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Venus-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127
Proper citation: RRID:Addgene_50650 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Venus-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127
Proper citation: RRID:Addgene_50656 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: mEos2-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127
Proper citation: RRID:Addgene_50652 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: CloverGFP-Tub1
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25711127
Proper citation: RRID:Addgene_50654 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: URA3 3' fragment
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24604451
Proper citation: RRID:Addgene_48233 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TEF1p 5' fragment
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24604451
Comments: Created by 4-part ligation with XhoI/EagI cut pBluescript II SK (-). Inserts were XhoI/XbaI TEF1p, XbaI/BamHI URA3, and BamHI/EagI TEF1p.
Proper citation: RRID:Addgene_48262 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: URA3 3' fragment
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24604451
Comments: pJH124 was created by cloning an XbaI/XhoI Ag TEF1 promoter fragment into the same sites of vector IpO. The cloned insert was confirmed by DNA sequencing.
Proper citation: RRID:Addgene_48259 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: mitochondrial targeting signal
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pAcGFP1-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21885730
Proper citation: RRID:Addgene_49151 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: eIF4E
Vector Backbone Description: Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864040
Proper citation: RRID:Addgene_37228 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: eIF4E
Vector Backbone Description: Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864040
Proper citation: RRID:Addgene_37229 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: eIF5B
Vector Backbone Description: Vector Backbone:pSKB3; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17913637
Proper citation: RRID:Addgene_37221 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HHtRNA
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17913637
Comments: HHtRNA sequence (rev orientation): TGGTAGCGCCGCTCGGTTTCGATCCGAGGACATCAGGGTTATGAGCCCTGCGCGCTTCCACTGCGCCACGGCGCTGACGGTACCGGGTACCGTTTCGTCCTCACGGACTCATCAGAGCG
Proper citation: RRID:Addgene_37222 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: eIF1
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17913637
Proper citation: RRID:Addgene_37217 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: eIF5
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17913637
Proper citation: RRID:Addgene_37219 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: HRC1
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864040
Proper citation: RRID:Addgene_37233 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Met3p-mCherry-Tub1
Vector Backbone Description: Backbone Size:4381; Vector Backbone:pRS306; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21294277
Proper citation: RRID:Addgene_37554 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Ras2 C-term (last 9 aa)
Vector Backbone Description: Backbone Size:4749; Vector Backbone:pKT0128; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19755860
Proper citation: RRID:Addgene_37557 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
