Plasmids   Select Another Resource Report Type

http://www.addgene.org/52707

Genetic Insert: ΔZA strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: lacZ and lacA deletion

Proper citation: RRID:Addgene_52707 Copy   

•   Source: Addgene
  

http://www.addgene.org/52713

Genetic Insert: W999L strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776

Proper citation: RRID:Addgene_52713 Copy   

•   Source: Addgene
  

http://www.addgene.org/52714

Genetic Insert: E537Q strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776

Proper citation: RRID:Addgene_52714 Copy   

•   Source: Addgene
  

http://www.addgene.org/52711

Genetic Insert: G794A strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776

Proper citation: RRID:Addgene_52711 Copy   

•   Source: Addgene
  

http://www.addgene.org/52712

Genetic Insert: W999F strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776

Proper citation: RRID:Addgene_52712 Copy   

•   Source: Addgene
  

http://www.addgene.org/52695

Genetic Insert: ΔZYA strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: MG1655 was transformed with pKD46 (carrying phage lambda Red recombinase) and a PCR fragment encoding a kanamycin resistance gene with flanking nucleotide sequences homologous to those flanking the lac operon. Upon recombination and selection for resistant strains, the kanamycin-resistant gene was eliminated following transformation with pCP20 (encoding the FLP recombinase), which is subsequently cured by growth at 30°C. The deletion in our ΔZYA strain started 20bp upstream of lacI and ran 40bp downstream of lacA.

Proper citation: RRID:Addgene_52695 Copy   

•   Source: Addgene
  

http://www.addgene.org/52698

Genetic Insert: OpLac1-Δ6 strain
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:22605776
Comments: Oplac1Δ6 were erroneously synthesized missing the first 6 nucleotides of Oplac1. These deletions correspond to the first 2 N-terminal amino acid residues (Methionine and Threonine), and instead begin at the Methionine at position 3.

Proper citation: RRID:Addgene_52698 Copy   

•   Source: Addgene
  

http://www.addgene.org/52942

Species: E.coli
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:25087841

Proper citation: RRID:Addgene_52942 Copy   

•   Source: Addgene
  

http://www.addgene.org/52950

Species: E.coli
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
Defining Citation: PMID:23878244

Proper citation: RRID:Addgene_52950 Copy   

•   Source: Addgene
  

http://www.addgene.org/188480

Genetic Insert: P-R-lox-TT-lox-catT172A
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188480 Copy   

•   Source: Addgene
  

http://www.addgene.org/188481

Genetic Insert: Ptet-Rtet-lox-TT-lox-tetA
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188481 Copy   

•   Source: Addgene
  

http://www.addgene.org/188477

Genetic Insert: P**-R-lox-TT-lox-knt
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188477 Copy   

•   Source: Addgene
  

http://www.addgene.org/188478

Genetic Insert: P-R*-lox-TT-lox-knt
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188478 Copy   

•   Source: Addgene
  

http://www.addgene.org/188479

Genetic Insert: P-R-lox-TT-lox-cat
Vector Backbone Description: Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_188479 Copy   

•   Source: Addgene
  

http://www.addgene.org/197656

Species: n/a
Genetic Insert: This strain is a derivative of BL21(DE3) with the serC gene knocked out
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:37122473
Comments: Strain is resistant to chloramphenicol. Derivative of BL21(DE3) with the serC gene knocked out. This strain is used for expressing proteins containing site-specific non-hydrolyzable phosphoserine. Primers for verification: - for serC deletion: CCTCAACGGTTTTACTCATTGCGATG, CGGGCAGATTAATAGTGCCATCGAC Additional reference: Rogerson et al. Efficient genetic encoding of phosphoserine and its nonhydrolyzable analog. Nat Chem Biol. 2015 Jul;11(7):496-503 Please visit https://www.biorxiv.org/content/10.1101/2021.10.22.465468v2 for bioRxiv preprint.

Proper citation: RRID:Addgene_197656 Copy   

•   Source: Addgene
  

http://www.addgene.org/197655

Species: n/a
Genetic Insert: This strain is a derivative of BL21(DE3) with no specific assignment of the UAG codo
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:31243963
Comments: Derivative of BL21(DE3) with no specific assignment of the UAG codon - 95 endogenous TAG codons mutated to TAA - RF1 (prfA) deleted and fabR spontaneously mutated - serB deleted for phosphoserine genetic code expansion expression applications Primers for verification: - for RF1 (prfA) deletion: AAGCCTTCTATCGTTGCCAAAC, TTATTCCTGCTCGGACAACG - for serB deletion: AGTTTTGTGCGAGCCATCTTCCACC, GTGATGGTGTTCCAGGCATGACAGG This strain is used for expressing phosphoserine-containig proteins using genetic code expansion without buildup of prematurely truncated protein - Recommended plasmids for expressing phosphorylated proteins in this strain are Addgene #173897 (pSer GCE machinery vector) and #174075/174076 (compatible p15a origin of replication plasmids expressing sfGFP proteins from a T7 promoter; sfGFP genes can be removed by restriction digest and replaced with protein-of-interest). Original B95 strain: Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672

Proper citation: RRID:Addgene_197655 Copy   

•   Source: Addgene
  

http://www.addgene.org/125258

Genetic Insert: single chromosomal copy of yhhX target sequence upstream from mcherry reporter gene under control of a constitutive promoter
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:31377338
Comments: Genotype: The expression of mcherry can be visualized or measured with a spectrophotometer. The yhhX target sequence followed by a mcherry reporter gene carried by an integrative vector based on pOSIP-KL was integrated at the lambda attB site in the chromosome of E. coli MG1655 and the backbone was flipped out using the pE-FLP (AmpR, #45978, Addgene) plasmid. This strain can be used to optimize dCas9 expression levels

Proper citation: RRID:Addgene_125258 Copy   

•   Source: Addgene
  

http://www.addgene.org/83308

Species: Mus musculus
Genetic Insert: FoxO1
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:3390; Vector Backbone:pSELECT-puro; Vector Types:Mammalian Expression; Bacterial Resistance:None
Defining Citation: PMID:27511131
Comments: To construct pSELECT-HA-mFOXO1 the coding sequence of HA tag and FOXO1 were amplified from pCMV-HA-FOXO1 by PCR. The PCR product was digested with NheI and SalI restriction enzymes and inserted into the NheI and SalI sites of pSELECT-puro. The insert was sequenced and compared to mouse FOXO1 (NM_019739.3). Sequence identity was confirmed except for a conservative A->G mutation at base 474, a non-conservative A->G mutation at base 1121 and a non-conservative mutation T->C mutation at base 2321 of NM_019739.3. These mutations were confirmed to exist in the original pCMV-HA-FOXO1 plasmid. The non-conservative mutations result in a K->R substitution at amino acid 219 and a L->P substitution at amino acid 619 of mFOXO1 (NP_062713.2). Mutations at bases 1121 and 2321 were reversed to wild type by site-directed mutagenesis and the corrections were confirmed by sequencing

Proper citation: RRID:Addgene_83308 Copy   

•   Source: Addgene
  

http://www.addgene.org/78551

Genetic Insert: pTet--dCas9 cassette integrated at 186 primary attB site.
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:27060147

Proper citation: RRID:Addgene_78551 Copy   

•   Source: Addgene
  

http://www.addgene.org/115925

Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29765036
Comments: E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-mCherry Integration at primary 186 attB: pOSIP-CO-RBS-librarydCas9 (2-3)* *Number in parentheses refers to the selected colony number. mCherry quantifies dCas9 repression

Proper citation: RRID:Addgene_115925 Copy   

•   Source: Addgene