Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pcDNA3-mouse PKA-RIbeta-mEGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_45526 | PKA regulatory subunit RI beta tagged by mEGFP | Mus musculus | Ampicillin | PMID:19447092 | Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:24 | 1 | ||
|
pcDNA4/TO mTRPM7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45482 | TRPM7 | Mus musculus | Ampicillin | PMID:11385574 | For the purpose of expressing LTRPC7 in eukaryotic cells, the depositing lab used PCR to produce an epitope tagged expression construct from two overlapping murine LTRPC7 clones. The LTRPC7 coding sequence was modified by removing the initiating methionine and replacing it with a sequence encoding a Kozak sequence, the FLAG tag and the additional sequence GCGGCCGCAT, and by placing a SpeI site just after the stop codon. These modifications result in an expressed protein which started with the following amino acid sequence: MGDYKDDDDKRPH followed by the murine LTRPC7 coding sequence starting at the second amino acid. This construct is expressed from the pcDNA4/TO vector which provides tetracycline-controlled expression from a CMV promotor. | Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4/TO (modified); Vector Types:Mammalian Expression, Tetracycline Inducible; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:24 | 2 | |
|
pcDNA3.1-Flag-PGC-1alpha1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45501 | PGC-1alpha Isoform1 | Mus musculus | Ampicillin | PMID:23217713 | Note that Addgene NGS results identified a Q339K mutation relative to the canonical GenBank sequence. This mutation has not been reported to affect function. | Backbone Size:5424; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Q339K relative to NM_008904 | 2026-08-15 01:15:24 | 1 |
|
pCAGGS-Hoxc6 Resource Report Resource Website |
RRID:Addgene_45553 | Hoxc6 | Mus musculus | Ampicillin | PMID:23359544 | Backbone Size:4800; Vector Backbone:pCAGGs; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:25 | 0 | ||
|
pCMV-Kl-EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_45532 | alpha Klotho | Mus musculus | Ampicillin and Kanamycin | PMID:26881702 | Backbone Size:5710; Vector Backbone:pCR3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:15:24 | 1 | ||
|
pD40-His/V5-c-Myc Resource Report Resource Website 1+ mentions |
RRID:Addgene_45597 | c-Myc | Mus musculus | Ampicillin | PMID:15048125 | Alternate plasmid names: pD40-His-c-Myc; pcDNA-DEST40 Myc wt This His6-tagged c-Myc plasmid was created by PCR amplification of the coding sequence for wild-type murine c-Myc2 from the CMVMyc plasmid (Hann et al., Genes Dev. 1994, PMID: 7958908) with a CACC 5′ extension added to the 5′ primer for cloning into the TOPO entry clone from Invitrogen (Carlsbad, CA). This sequence was then moved into the pDEST-40 mammalian expression vector using Gateway technology (Invitrogen), creating pD40-His-c-Myc. For plasmid usage information, see the associated article (Yeh et al. Nat Cell Biol. 2004) as well as Arnold et al. EMBO 2009 (PMID: 19131971). | Backbone Marker:Invitrogen; Backbone Size:7143; Vector Backbone:pcDNA DEST40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:25 | 9 | |
|
pCRII-Topo Lpl in situ probe Resource Report Resource Website |
RRID:Addgene_45630 | Lpl in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Lpl fragment was amplified by RT-PCR using the following primer pair: TGCTGTGCAAAGAGAAGAGC CGGACACAAAGTTAGCACCA For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 3249-3900 of NM_008509.2, not bp# 3169-3826 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 3249-3900 of NM_008509.2 | 2026-08-15 01:15:25 | 0 |
|
pCRII-Topo Nectin-3 in situ probe Resource Report Resource Website |
RRID:Addgene_45633 | Nectin-3 in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Nectin-3 fragment was amplified by RT-PCR using the following primer pair: AAACAACCTGATCCGCAAAG CAGTGAAAACTGTAAAGCAGCTC For in vitro transcription, use the BamHI restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1626-2039 of NM_021495, not bp# 1624-2036 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 1626-2039 of NM_021495 | 2026-08-15 01:15:25 | 0 |
|
pCRII-Topo Ptn in situ probe Resource Report Resource Website |
RRID:Addgene_45632 | Ptn in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Ptn fragment was amplified by RT-PCR using the following primer pair: GCCTACCCGTCCAAATATCC GCCAGTTCTGGTCTTCAAGG For in vitro transcription, use the NotI restriction digest and SP6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1241-1830 of NM_008973, not bp# 1238-1827 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 1241-1830 of NM_008973 | 2026-08-15 01:15:25 | 0 |
|
pCRII-Topo Gp88 in situ probe Resource Report Resource Website |
RRID:Addgene_45628 | Gpr88 in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Gpr88 fragment was amplified by RT-PCR using the following primer pair: CAAATGAAACCAATGGTCAGG TATCTGTTTCCCGTGTCTCC For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 2742-3255 of AB042408.1 or bp# 2772-3285 of NM_022427, not bp# 2742-3255 of NM_022427 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 2742-3255 of AB042408.1 or bp# 2772-3285 of NM_022427 | 2026-08-15 01:15:25 | 0 |
|
pCRII-Topo Foxp2 in situ probe Resource Report Resource Website |
RRID:Addgene_45620 | Foxp2 in situ probe | Mus musculus | Ampicillin | PMID:16157277 | The Fox2p fragment was amplified by RT-PCR using the following primer pair: CAGTGTGGACTGTGGACGAA TTCCAGGTCCTCAGATAAAGG For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp#1709-2142 of AF339106, not bp# 1707-2142 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp#1709-2142 of AF339106 | 2026-08-15 01:15:25 | 0 |
|
pCRII-Topo Tcrb-V13 in situ probe Resource Report Resource Website |
RRID:Addgene_45622 | Tcrb-V13 in situ probe | Mus musculus | Ampicillin | PMID:16157277 | The Tcrb-V13 fragment was amplified by RT-PCR using the following primer pair: CTGAGCTGGTGGGTGAATG AAGGTGTCAACGAGGAAGGA For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 533-1058 of X67128, not bp# 532-1059 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 533-1058 of X67128 | 2026-08-15 01:15:25 | 0 |
|
pCRII-Topo Plexin D1 in situ probe Resource Report Resource Website |
RRID:Addgene_45621 | Plexin D1 in situ probe | Mus musculus | Ampicillin | PMID:16157277 | The Plexin D1 fragment was amplified by RT-PCR using the following primer pair: CAGGAAATGAACGCACACC TGAGGGACACAGACAACTGC; For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 5751-6406 of NM_026376.3 | 2026-08-15 01:15:25 | 0 |
|
pCRII-Topo Cux2 in situ probe Resource Report Resource Website |
RRID:Addgene_45623 | Cux2 in situ probe | Mus musculus | Ampicillin | PMID:16157277 | The Cux2 fragment was amplified by RT-PCR using the following primer pair: TCAGTCAACAGCTCCATTCG GACAGCGAGAAAGTCCTTGG For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains nt 1069-1694 on NM_007804 | 2026-08-15 01:15:25 | 0 |
|
pCRII-Topo Crim1 in situ probe Resource Report Resource Website |
RRID:Addgene_45600 | Crim1 in situ probe | Mus musculus | Ampicillin | PMID:15664173 | Fragment was amplified using the following primers: TCTCAAGACTGTTGGTTGCTG TGAACAACCAATGATAGCACAG For in vitro transcription, use the NotI restriction digest and SP6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp#4062-4502 of NM_015800.3, not bp# 4708-5148 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | insert contains bp#4062-4502 of NM_015800.3 | 2026-08-15 01:15:25 | 0 |
|
pCRII-Topo Diap3 in situ probe Resource Report Resource Website 1+ mentions |
RRID:Addgene_45602 | Diap3 in situ probe | Mus musculus | Ampicillin | PMID:15664173 | Fragment was amplified using the following primers: AGCAGTTCGCTGTTGTGATG GCACGTTTCTCCTTTTCTGC For in vitro transcription, use the SpeI restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1589-2321 of BC028920, not bp# 1610-2321 as indicated on plasmid map. The plasmid functions as described in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | fragment contains bp# 1589-2321 of BC028920 | 2026-08-15 01:15:25 | 1 |
|
FLAG-VAMP7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_45913 | vesicle-associated membrane protein 7 | Mus musculus | Ampicillin | PMID:23217709 | Backbone Size:6400; Vector Backbone:CMV10 FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:27 | 1 | ||
|
pCRII-Topo Grp Resource Report Resource Website |
RRID:Addgene_45871 | GRP in situ probe | Mus musculus | Ampicillin | For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | nt 66-504 on NM_175012 | 2026-08-15 01:15:27 | 0 | |
|
pCRII-Topo Inhba Resource Report Resource Website |
RRID:Addgene_45868 | Inhba in situ probe | Mus musculus | Ampicillin | PMID:19793993 | The Inhba fragment was amplified by RT-PCR using the following primer pair: GCGATCAGAAAGCTTCATGTG AGACTGGCACCACTCTCCTG For in vitro transcription, use the Spe1 restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation. | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin | nt 428-933 from Inhba mRNA (NM_008380.1) | 2026-08-15 01:15:27 | 0 |
|
pEGFP eIF2beta C-term (aa 89-331) Resource Report Resource Website |
RRID:Addgene_45901 | eIF2S2 aa89-331 | Mus musculus | Kanamycin | PMID:11959995 | PCR amplified using EcoRI/BamHI containing primers. G321D mutation is also present. | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | aa 89-331 | 2026-08-15 01:15:27 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
