Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:saccharomyces cerevisiae (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

4,486 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pHIS3p:CloverGFP-Tub1+3'UTR::LEU2
 
Resource Report
Resource Website
RRID:Addgene_50642 CloverGFP-Tub1 Saccharomyces cerevisiae Ampicillin PMID:25711127 Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:07 0
pHIS3p:yomWasabi-Tub1+3'UTR::LEU2
 
Resource Report
Resource Website
RRID:Addgene_50643 yomWasabi-Tub1 Saccharomyces cerevisiae Ampicillin PMID:25711127 Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:07 0
pHIS3p:yomWasabi-Tub1+3'UTR::TRP1
 
Resource Report
Resource Website
RRID:Addgene_50649 yomWasabi-Tub1 Saccharomyces cerevisiae Ampicillin PMID:25711127 Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:07 0
pHIS3p:Venus-Tub1+3'UTR::TRP1
 
Resource Report
Resource Website
RRID:Addgene_50650 Venus-Tub1 Saccharomyces cerevisiae Ampicillin PMID:25711127 Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 0
pHIS3p:Venus-Tub1+3'UTR::HIS3
 
Resource Report
Resource Website
RRID:Addgene_50656 Venus-Tub1 Saccharomyces cerevisiae Ampicillin PMID:25711127 Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 0
pHIS3p:mEos2-Tub1+3'UTR::TRP1
 
Resource Report
Resource Website
RRID:Addgene_50652 mEos2-Tub1 Saccharomyces cerevisiae Ampicillin PMID:25711127 Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:07 0
pHIS3p:CloverGFP-Tub1+3'UTR::HIS3
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_50654 CloverGFP-Tub1 Saccharomyces cerevisiae Ampicillin PMID:25711127 Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:07 1
IpO
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_48233 URA3 3' fragment Saccharomyces cerevisiae Ampicillin PMID:24604451 Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin URA3 ORF from +216 to 80 bp downstream of the stop codon 2026-08-15 01:15:48 1
pJH104
 
Resource Report
Resource Website
RRID:Addgene_48262 TEF1p 5' fragment Saccharomyces cerevisiae Ampicillin PMID:24604451 Created by 4-part ligation with XhoI/EagI cut pBluescript II SK (-). Inserts were XhoI/XbaI TEF1p, XbaI/BamHI URA3, and BamHI/EagI TEF1p. Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin From SK1 background. -460 to -128 relative to TEF1 ORF 2026-08-15 01:15:48 0
pJH124
 
Resource Report
Resource Website
RRID:Addgene_48259 URA3 3' fragment Saccharomyces cerevisiae Ampicillin PMID:24604451 pJH124 was created by cloning an XbaI/XhoI Ag TEF1 promoter fragment into the same sites of vector IpO. The cloned insert was confirmed by DNA sequencing. Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin URA3 ORF from +216 to 80 bp downstream of the stop codon 2026-08-15 01:15:49 0
mito-BFP
 
Resource Report
Resource Website
50+ mentions
RRID:Addgene_49151 mitochondrial targeting signal Saccharomyces cerevisiae Kanamycin PMID:21885730 Backbone Marker:Clontech; Vector Backbone:pAcGFP1-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:56 59
pET15b-eIF4E
 
Resource Report
Resource Website
RRID:Addgene_37228 eIF4E Saccharomyces cerevisiae Ampicillin PMID:20864040 Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0
pET15b-eIF4E-S200C
 
Resource Report
Resource Website
RRID:Addgene_37229 eIF4E Saccharomyces cerevisiae Ampicillin PMID:20864040 Backbone Marker:EMD bioscience; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin S200C 2026-08-15 01:14:13 0
pMGAHisTev5B
 
Resource Report
Resource Website
RRID:Addgene_37221 eIF5B Saccharomyces cerevisiae Kanamycin PMID:17913637 Vector Backbone:pSKB3; Vector Types:; Bacterial Resistance:Kanamycin N-term truncation (contains aa 396-1002) 2026-08-15 01:14:13 0
pUC19-HHtRNA
 
Resource Report
Resource Website
RRID:Addgene_37222 HHtRNA Saccharomyces cerevisiae Ampicillin PMID:17913637 HHtRNA sequence (rev orientation): TGGTAGCGCCGCTCGGTTTCGATCCGAGGACATCAGGGTTATGAGCCCTGCGCGCTTCCACTGCGCCACGGCGCTGACGGTACCGGGTACCGTTTCGTCCTCACGGACTCATCAGAGCG Backbone Size:2686; Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0
pTYB2-eIF1
 
Resource Report
Resource Website
RRID:Addgene_37217 eIF1 Saccharomyces cerevisiae Ampicillin PMID:17913637 Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0
pTYB2-eIF5
 
Resource Report
Resource Website
RRID:Addgene_37219 eIF5 Saccharomyces cerevisiae Ampicillin PMID:17913637 Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0
pTYB2-HCR1
 
Resource Report
Resource Website
RRID:Addgene_37233 HRC1 Saccharomyces cerevisiae Ampicillin PMID:20864040 Backbone Marker:NEB; Backbone Size:7474; Vector Backbone:pTYB2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:13 0
pRS306:Met3p-mCherry-Tub1
 
Resource Report
Resource Website
RRID:Addgene_37554 Met3p-mCherry-Tub1 Saccharomyces cerevisiae Ampicillin PMID:21294277 Backbone Size:4381; Vector Backbone:pRS306; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:15 0
pKT0128-RAS2 C-term
 
Resource Report
Resource Website
RRID:Addgene_37557 Ras2 C-term (last 9 aa) Saccharomyces cerevisiae Ampicillin PMID:19755860 Backbone Size:4749; Vector Backbone:pKT0128; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:15 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.