Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31719930
Proper citation: RRID:Addgene_133592 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Linus
Vector Backbone Description: Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31719930
Proper citation: RRID:Addgene_133590 Copy
Species: Other
Genetic Insert: sfGFP(SPS6)
Vector Backbone Description: Backbone Marker:Frenzel etal. 2018; Vector Backbone:pNW-Ppta-3TER; Vector Types:Bacterial Expression, E.coli/Bacillus spp. shuttle vector; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29195004
Proper citation: RRID:Addgene_133814 Copy
Species: Synthetic
Genetic Insert: sfGFP(Sp)
Vector Backbone Description: Vector Backbone:pAD43-25; Vector Types:Bacterial Expression, E.coli/Bacillus spp. shuttle vector; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29195004
Proper citation: RRID:Addgene_133833 Copy
Species: Synthetic
Genetic Insert: mKate(KPS12)
Vector Backbone Description: Backbone Marker:Dunn and Handelsman, 1999; Vector Backbone:pAD43-25; Vector Types:Bacterial Expression, E.coli/Bacillus spp. shuttle vector; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29195004
Proper citation: RRID:Addgene_133831 Copy
Species: Synthetic
Genetic Insert: sfGFP(SPS6)
Vector Backbone Description: Backbone Marker:Dunn and Handelsman, 1999; Vector Backbone:pAD43-25; Vector Types:Bacterial Expression, E.coli/Bacillus spp. shuttle vector; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29195004
Proper citation: RRID:Addgene_133906 Copy
Vector Backbone Description: Backbone Size:11151; Vector Backbone:pBAC-lacZ; Vector Types:Bacterial Expression, Cre/Lox; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:17406455
Comments: The complete assembled sequence for this plasmid may not be accurate. Addgene suggests sequence verifying the construct before starting your experiments.
Bacterial cell-based two-hybrid (B2H) reporter vector. Use 12.5 ug/ml chloramphenicol for growth.
The pBAC-lacZ plasmid is a mini-F' that can be replicated in standard E. coli strains, but because it is maintained as a single copy episome, it gives low DNA yields. pBAC-lacZ also contains a second, higher copy number origin of replication (oriV) that is only active in the presence of a trans-acting factor encoded by the trfA gene. Transformax EPI300 cells express trfA from an
inducible promoter that we have found is inducible with arabinose. When the trfA gene is induced in Transformax EPI300 cells, the copy number of pBAC-lacZ plasmid is increased in the cells and reasonable yields of plasmid can be obtained using a standard miniprep procedure.
Further notes on propagating this plasmid: grow an overnight culture (without arabinose) and then the next morning subculture 1:10 into medium that has a final concentration of arabinose of 1 mM. You then grow this culture for 5 to 6 hours at 37 C and then harvest the DNA.
Proper citation: RRID:Addgene_13422 Copy
Species: Synthetic
Genetic Insert: cmR_gp41-1 N-intein + cmR_gp41-1 C-intein
Vector Backbone Description: Vector Backbone:pBAD33 + pTrc99a; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31672972
Comments: pSiMPlc_N should be cotransformed with pSiMPlc_C (or vice versa) in E. Coli to get a reconstituted functional CAT thereby conferring resistance against chloramphenicol. mRuby3 gene was amplified from a construct bought by us from Addgene (ID: 74252).
Please see the Sequences link for the individual plasmid sequences.
The sample from Addgene will have both the plasmids pSiMPlc_N + pSiMPlc_C in it for the interested
antibiotic resistance. Separating individual plasmid backbones will be possible via PCR. Agarose gel electrophoresis can be used to visualize the presence of both the plasmids. But, separating individual plasmids via gel electrophoresis, in our hands, always resulted in cross-contamination of the two backbones.
Proper citation: RRID:Addgene_134312 Copy
Vector Backbone Description: Backbone Marker:Spaink; Backbone Size:15000; Vector Backbone:pMP184; Vector Types:Bacterial Expression, IncQ; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24276795
Comments: The plasmid also confers streptomycin resistance.
Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_185922 Copy
Species: n/a
Genetic Insert: Replaced lacI gene with chloramphenicol acetyltransferase (cat) selection cassette in the parent strain BW27783.
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24382032
Comments: MK01 strain was derived by knocking out the endogenous lacI gene with chloramphenicol acetyltransferase (cat) selection cassette in the parent strain BW27783. The parent strain encodes araC gene but carries a deletion for the arabinose metabolizing genes, ∆(araH-araF). The all-or-none response of araBAD promoter (PBAD) response is overcome by inserting a copy of the low-affinity high-capacity transporter, araE, under the control of an arabinose-independent promoter.
Proper citation: RRID:Addgene_195090 Copy
Species: Acropora millepora
Genetic Insert: Amber Chromogenic Protein on pRCPam plasmid
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain carrying pRCPam; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38107993
Comments: Primer sequences for confirmation of suppressor mutation:
Sense PCR primer (5'-->3') - TTGAGGTAATGCTTGAGATGG
Antisense PCR primer (5'-->3') - TCCTGCCAGCGTTTATTG
Sequencing primer (5'-->3') - CACAGCGCGTCTTTGTTTAC
Proper citation: RRID:Addgene_195857 Copy
Species: Acropora millepora
Genetic Insert: Amber Chromogenic Protein on pRCPam plasmid
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain carrying pRCPam; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38107993
Comments: Primer sequences for confirmation of suppressor mutation:
Sense PCR primer (5'-->3') - CTGTCAGATCCATAGCGAATC
Antisense PCR primer (5'-->3') - CTCTGACCTGACTGAACAATAC
Sequencing primer (5'-->3') - GCTATCCGGCAGCTTCTTAAT
Proper citation: RRID:Addgene_195856 Copy
Species: Acropora millepora
Genetic Insert: Amber Chromogenic Protein on pRCPam plasmid
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain carrying pRCPam; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38107993
Proper citation: RRID:Addgene_195859 Copy
Species: Acropora millepora
Genetic Insert: Amber Chromogenic Protein on pRCPam plasmid
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain carrying pRCPam; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38107993
Comments: Primer sequences for confirmation of suppressor mutation:
Sense PCR primer (5'-->3') - TCCTTCTCTGGTGTTGTTTG
Antisense PCR primer (5'-->3') - TTGGCTGCTCTGACTTTG
Sequencing primer (5'-->3') - CGGTTGACCTTGAGAGAGTTAAT
Proper citation: RRID:Addgene_195858 Copy
Species: Acropora millepora
Genetic Insert: Chromogenic Protein on pRCP plasmid
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain carrying pRCP; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38107993
Proper citation: RRID:Addgene_195860 Copy
Species: Acropora millepora
Genetic Insert: Chromogenic Protein
Vector Backbone Description: Backbone Marker:Reference for backbone - PMID: 10723548; Vector Backbone:pDHC; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38107993
Proper citation: RRID:Addgene_195862 Copy
Genetic Insert: P*-loxP-TT-loxP-R-knt
Vector Backbone Description: Backbone Size:2067; Vector Backbone:pBbA-c; Vector Types:Bacterial Expression, Cre/Lox, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_189850 Copy
Genetic Insert: P-loxP-TT-loxP-R*-knt
Vector Backbone Description: Backbone Size:2067; Vector Backbone:pBbA-c; Vector Types:Bacterial Expression, Cre/Lox, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_189852 Copy
Species: Synthetic
Genetic Insert: 92-1 Op (Part 2)
Vector Backbone Description: Backbone Size:1658; Vector Backbone:pYKT001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:36367334
Proper citation: RRID:Addgene_194487 Copy
Genetic Insert: P-loxP-TT-loxP-R-knt
Vector Backbone Description: Backbone Size:2261; Vector Backbone:pBbA-c; Vector Types:Bacterial Expression, Cre/Lox, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:36823420
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_189849 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
